ID: 1043394704

View in Genome Browser
Species Human (GRCh38)
Location 8:79825265-79825287
Sequence CTTCCCTACCTGGCAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043394694_1043394704 -4 Left 1043394694 8:79825246-79825268 CCACCTTTCCCCCAAGAACCTTC No data
Right 1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG No data
1043394695_1043394704 -7 Left 1043394695 8:79825249-79825271 CCTTTCCCCCAAGAACCTTCCCT No data
Right 1043394704 8:79825265-79825287 CTTCCCTACCTGGCAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043394704 Original CRISPR CTTCCCTACCTGGCAGAAAG GGG Intergenic
No off target data available for this crispr