ID: 1043401823

View in Genome Browser
Species Human (GRCh38)
Location 8:79891837-79891859
Sequence TGTGAAAGAGCAGCGGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043401823_1043401825 -5 Left 1043401823 8:79891837-79891859 CCGGCAGCCGCTGCTCTTTCACA No data
Right 1043401825 8:79891855-79891877 TCACAGCCCCAGACCCTGCGCGG No data
1043401823_1043401833 10 Left 1043401823 8:79891837-79891859 CCGGCAGCCGCTGCTCTTTCACA No data
Right 1043401833 8:79891870-79891892 CTGCGCGGCCTGCCGGCGGCTGG No data
1043401823_1043401829 3 Left 1043401823 8:79891837-79891859 CCGGCAGCCGCTGCTCTTTCACA No data
Right 1043401829 8:79891863-79891885 CCAGACCCTGCGCGGCCTGCCGG No data
1043401823_1043401830 6 Left 1043401823 8:79891837-79891859 CCGGCAGCCGCTGCTCTTTCACA No data
Right 1043401830 8:79891866-79891888 GACCCTGCGCGGCCTGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043401823 Original CRISPR TGTGAAAGAGCAGCGGCTGC CGG (reversed) Intergenic
No off target data available for this crispr