ID: 1043401909

View in Genome Browser
Species Human (GRCh38)
Location 8:79892071-79892093
Sequence GAGGCGCCCCGGCAGGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043401909_1043401917 3 Left 1043401909 8:79892071-79892093 CCGACCTCCTGCCGGGGCGCCTC No data
Right 1043401917 8:79892097-79892119 GGCCCCTGCCCCACATCAGAGGG No data
1043401909_1043401926 24 Left 1043401909 8:79892071-79892093 CCGACCTCCTGCCGGGGCGCCTC No data
Right 1043401926 8:79892118-79892140 GGTCTTGCGGTTTCCTGGTTTGG No data
1043401909_1043401916 2 Left 1043401909 8:79892071-79892093 CCGACCTCCTGCCGGGGCGCCTC No data
Right 1043401916 8:79892096-79892118 GGGCCCCTGCCCCACATCAGAGG No data
1043401909_1043401925 19 Left 1043401909 8:79892071-79892093 CCGACCTCCTGCCGGGGCGCCTC No data
Right 1043401925 8:79892113-79892135 CAGAGGGTCTTGCGGTTTCCTGG No data
1043401909_1043401922 11 Left 1043401909 8:79892071-79892093 CCGACCTCCTGCCGGGGCGCCTC No data
Right 1043401922 8:79892105-79892127 CCCCACATCAGAGGGTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043401909 Original CRISPR GAGGCGCCCCGGCAGGAGGT CGG (reversed) Intergenic
No off target data available for this crispr