ID: 1043404416

View in Genome Browser
Species Human (GRCh38)
Location 8:79916062-79916084
Sequence CTATAGAAACAATTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043404416_1043404425 27 Left 1043404416 8:79916062-79916084 CCCACCCCCAATTGTTTCTATAG No data
Right 1043404425 8:79916112-79916134 CTAAATTGCCAGAATCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043404416 Original CRISPR CTATAGAAACAATTGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr