ID: 1043405699

View in Genome Browser
Species Human (GRCh38)
Location 8:79930219-79930241
Sequence CTTAATTAACTAGGCAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043405694_1043405699 22 Left 1043405694 8:79930174-79930196 CCTGGATAGATGGCCAGCTAAGT 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1043405699 8:79930219-79930241 CTTAATTAACTAGGCAACACAGG No data
1043405695_1043405699 9 Left 1043405695 8:79930187-79930209 CCAGCTAAGTTGTGTTTCAGATA 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1043405699 8:79930219-79930241 CTTAATTAACTAGGCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043405699 Original CRISPR CTTAATTAACTAGGCAACAC AGG Intronic
No off target data available for this crispr