ID: 1043406744

View in Genome Browser
Species Human (GRCh38)
Location 8:79943720-79943742
Sequence GAATGTATGCAGAGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 394}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043406744 Original CRISPR GAATGTATGCAGAGAGGGGA GGG (reversed) Intronic
902593171 1:17489454-17489476 AAATGTACCCAGAGATGGGAAGG + Intergenic
902654939 1:17860595-17860617 GAATGGTGGCAGGGAGGGGAGGG - Intergenic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
903505055 1:23827781-23827803 GAATGATTGGAGAGCGGGGAGGG + Intronic
903681378 1:25099579-25099601 GGCTGCATGCAGAGAGAGGAGGG - Intergenic
904391074 1:30186500-30186522 GAATGAATGGATAGATGGGATGG - Intergenic
904405673 1:30286520-30286542 GCATGCATGCAGGGAGAGGAGGG + Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905183025 1:36178202-36178224 GTAGGAATGAAGAGAGGGGAGGG + Intronic
907360963 1:53914385-53914407 GAATGTTTTGAGAAAGGGGATGG + Intergenic
907796599 1:57724323-57724345 GAAGGAAGGAAGAGAGGGGAGGG + Intronic
908625851 1:66040844-66040866 TAAAGTATGGAGAAAGGGGAGGG + Intronic
908771982 1:67605820-67605842 AGATGTATGTAGAGAGAGGAGGG + Intergenic
910191994 1:84604327-84604349 CATTGTGTACAGAGAGGGGATGG - Intergenic
910324804 1:85994479-85994501 GAATGTATGCAGAGGGAGAGAGG + Intronic
910709431 1:90164252-90164274 GAATGTATTCAGGGAGGCAAAGG - Intergenic
911751013 1:101498297-101498319 GAAAGTAAGGAGATAGGGGAAGG - Intergenic
912904501 1:113689616-113689638 GAAGGGATGCAGGGAGGGGGTGG + Intergenic
913335330 1:117704251-117704273 GAACATATGGAGGGAGGGGATGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916017996 1:160767265-160767287 GAAGAGATACAGAGAGGGGAGGG + Intergenic
916659288 1:166906431-166906453 GAAAGTGCTCAGAGAGGGGAAGG + Intergenic
916933542 1:169604606-169604628 GAATGTAGCTAGAGAGGGGAAGG - Intronic
918073776 1:181153476-181153498 GCACTAATGCAGAGAGGGGATGG - Intergenic
918254837 1:182739859-182739881 GAATCTAAGCAGGGAAGGGAAGG + Intergenic
919691346 1:200531207-200531229 GAAAGTCTGCAGAGAGCGGAAGG - Intergenic
920100789 1:203515795-203515817 GAATGCAAGCAGAGTGGGGTGGG + Intergenic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
920927235 1:210353230-210353252 AAATGTAAACAGAGAGGGGCCGG - Intronic
921556523 1:216604742-216604764 GAATGTATGCAGGGTGGTTAGGG - Intronic
921804411 1:219437504-219437526 AAATGTAGGGAGGGAGGGGAAGG - Intergenic
923189837 1:231609992-231610014 GAAGTTTTGCAGAGAAGGGAGGG - Intronic
924525765 1:244846546-244846568 GAAAGTCTGGATAGAGGGGAAGG - Intronic
924641039 1:245834097-245834119 GAACCTATGAATAGAGGGGAAGG + Intronic
1063164307 10:3446074-3446096 GGATCTCTGCAGACAGGGGAAGG - Intergenic
1063743457 10:8852773-8852795 GAATGTCGGGAGAGAGGAGAAGG + Intergenic
1065076470 10:22084527-22084549 GAATGTCTGCAGAGGGAGGGAGG + Intergenic
1068292646 10:55024145-55024167 GAATATATATAGAGAGAGGAAGG + Intronic
1068292648 10:55024167-55024189 GAATATATATAGAGAGAGGAAGG + Intronic
1068880187 10:62040118-62040140 GAATGGAGAGAGAGAGGGGAAGG - Intronic
1071573090 10:86708630-86708652 GAATCTATCCAGAGAAGGGCAGG + Intronic
1073042951 10:100619767-100619789 GAAGGTTTGGAGAGAGGGGTGGG - Intergenic
1075559518 10:123458441-123458463 GAAGGGAGGCAGAGAGAGGAGGG - Intergenic
1076381206 10:130025524-130025546 GGATGCATGCACAGAGGGTAAGG + Intergenic
1076771783 10:132670039-132670061 GAACGTGTGCAGTGAGGGCATGG - Intronic
1078129080 11:8596977-8596999 GGAGGGAGGCAGAGAGGGGAGGG + Intergenic
1078149491 11:8746574-8746596 GAGTGAATGCAGAGGAGGGAGGG + Intronic
1078186424 11:9055498-9055520 GGCTGTATTCAGAGAGTGGAAGG - Intronic
1078350549 11:10589662-10589684 GAATGGTTGCAAAGAGGTGAGGG - Intronic
1078353015 11:10610626-10610648 GAATGTGTGCAGGAATGGGATGG - Intronic
1080683355 11:34496060-34496082 GGGTGGAAGCAGAGAGGGGAGGG - Intronic
1080995944 11:37601982-37602004 GAATGTGTGCATAGAGGCAAAGG - Intergenic
1081365537 11:42230538-42230560 TAATTTATGGAGAGAGAGGAGGG + Intergenic
1081527144 11:43934971-43934993 AGATGGAAGCAGAGAGGGGAGGG - Intronic
1081789956 11:45775532-45775554 GAAGGGAGGCAGAGAGGGGAGGG - Intergenic
1082806086 11:57451785-57451807 GAATGCATGCGGAGTGGTGAGGG - Intergenic
1085786984 11:79461450-79461472 AAATGTAATCAGAGAGGGGAGGG - Intergenic
1086889988 11:92246282-92246304 GCATGTAGGCAGAGAGGAGAGGG + Intergenic
1086929862 11:92681294-92681316 TGATGTAAGCAGAGAAGGGAAGG + Intronic
1087393688 11:97570152-97570174 GAATGTATGTTTAAAGGGGAAGG - Intergenic
1087676880 11:101173874-101173896 GAATGTATGAAGAAAATGGAGGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089823229 11:121247037-121247059 TAAAGTATGCAGACAGGTGAAGG - Intergenic
1090642187 11:128739362-128739384 GAAAGTAGGTAGAGAGGGAAAGG + Intronic
1091124185 11:133081838-133081860 GGCTGTATGCGGAGAGGGGCGGG - Intronic
1091363799 11:135000319-135000341 GACCGTATGCAGAGAGGTGGAGG + Intergenic
1091614601 12:2039939-2039961 GGATTTATGCAAAGAGGAGATGG + Intronic
1092019510 12:5189200-5189222 GCATCTTTGCAGAGTGGGGATGG + Intergenic
1092124323 12:6064951-6064973 GCATCTAGGGAGAGAGGGGATGG + Intronic
1095635057 12:44423136-44423158 AAATGTATGAAGATAGGTGATGG - Intergenic
1097748275 12:63323982-63324004 GAGTGTAACCAGAGAGGGCATGG + Intergenic
1098265807 12:68718115-68718137 GAATGAAGGCACAGAGAGGAGGG - Intronic
1098523626 12:71461643-71461665 GAATGTTGGTAGAGAGGGGAAGG - Intronic
1098602608 12:72350133-72350155 GAATATATGCAGAGACAGGATGG - Intronic
1100225474 12:92551787-92551809 AAATGTAGGGAGAGAGGGTAAGG + Intergenic
1101255517 12:102973450-102973472 GAAGGGAGGCAGAGAGGGGGAGG - Intergenic
1101294180 12:103403650-103403672 CCATGTCTGCAGGGAGGGGAAGG + Intronic
1101586284 12:106088694-106088716 GAGTGTATGCTGTAAGGGGAAGG - Intronic
1101818424 12:108163686-108163708 GAATGCAGGCAGGAAGGGGAGGG + Intronic
1102986526 12:117283002-117283024 TAATCTGTGCATAGAGGGGAAGG - Intronic
1104162758 12:126195959-126195981 GAATGCATGCAGAGAGTGTAAGG + Intergenic
1104481552 12:129112238-129112260 GAATGTATGAAAAGTTGGGAAGG + Intronic
1106565364 13:30880163-30880185 GGATGCTCGCAGAGAGGGGAAGG - Intergenic
1107654812 13:42580804-42580826 GAAAGTGTTCATAGAGGGGAGGG - Intronic
1108379976 13:49846242-49846264 GAACAAATGCACAGAGGGGAGGG + Intergenic
1109446997 13:62454008-62454030 GAACCTATGCAGATATGGGAGGG + Intergenic
1110388672 13:74945565-74945587 CAATGGAGGCAGGGAGGGGAGGG + Intergenic
1110388681 13:74945588-74945610 CAATGGAGGCAGGGAGGGGAGGG + Intergenic
1112194000 13:97207067-97207089 GAATGCATGCAGGAAAGGGAAGG - Intergenic
1112329477 13:98465897-98465919 GAAAGTAGGCAGGAAGGGGAGGG + Intronic
1112421493 13:99254342-99254364 GAATGAATTCAGAGTAGGGAAGG + Intronic
1112577050 13:100645223-100645245 GAGTGTATGCTGGGAGGGGCTGG - Intronic
1112794939 13:103046688-103046710 GAATGAAGGCAGGGAGGGAATGG - Intronic
1112835728 13:103512040-103512062 GAATCTAAGCAGAAAGAGGAGGG + Intergenic
1112958905 13:105097244-105097266 GAATGTAGGTAGAGAAGGGTTGG + Intergenic
1113477377 13:110594168-110594190 GCTTTTAGGCAGAGAGGGGAGGG - Intergenic
1113513421 13:110873093-110873115 GAAGGTTTGCAGGGTGGGGAAGG - Intergenic
1113597713 13:111546423-111546445 GAATGATTGCATATAGGGGAAGG + Intergenic
1113618497 13:111697375-111697397 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113624026 13:111782636-111782658 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113754816 13:112803920-112803942 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754849 13:112804021-112804043 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754871 13:112804081-112804103 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754891 13:112804134-112804156 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754906 13:112804178-112804200 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754927 13:112804230-112804252 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754944 13:112804273-112804295 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754967 13:112804334-112804356 GAACGAGGGCAGAGAGGGGATGG - Intronic
1113754987 13:112804386-112804408 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113755011 13:112804448-112804470 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1117652038 14:57917352-57917374 AAATGTAAGCAGAGAGGGCTGGG - Intronic
1118224302 14:63884628-63884650 GAGTGTGTGCAAAGACGGGAAGG + Intronic
1118288484 14:64499832-64499854 GAATGTTAGCAAAGAGGGTATGG + Intronic
1119556962 14:75560647-75560669 GAATGGGTGCAAGGAGGGGAAGG + Intergenic
1119980766 14:79078444-79078466 GAATGTATGCAGAGCAAGGTTGG - Intronic
1122372035 14:101234217-101234239 GCTTGTTTGCAGAGAGAGGAAGG + Intergenic
1123893985 15:24809767-24809789 CAATGTTGGCACAGAGGGGATGG - Intergenic
1125884404 15:43217970-43217992 GAAAGTGTGCAGAGGAGGGAAGG + Intronic
1126417613 15:48434073-48434095 GAATGTATGGAAAGAAGGAAAGG - Intronic
1127072098 15:55297048-55297070 AAATGCATCCAGAGAGGGGAGGG + Intronic
1129275394 15:74442114-74442136 CAGTGGATGCAGAGAGGGCAGGG - Intergenic
1129299968 15:74619860-74619882 GGAAGTGGGCAGAGAGGGGAGGG - Intronic
1130236389 15:82138606-82138628 GAATGTATCCATAGATGAGAAGG + Intronic
1135361669 16:21820597-21820619 GAGTGTAAGGAGAGACGGGAAGG + Intergenic
1136367129 16:29814028-29814050 GGATCCATGCAGAGAGGAGAGGG - Intronic
1136516711 16:30772945-30772967 GAATGCATGGAGTGAGGGAAAGG + Intronic
1136578475 16:31138462-31138484 GAATGAATGCAGGGAGGTGCAGG + Intergenic
1138370506 16:56523095-56523117 GAAGTTATGAAGGGAGGGGAAGG - Intergenic
1139530417 16:67539911-67539933 GCATGTGTGCAGAGTGGGGTGGG + Intronic
1140272925 16:73482477-73482499 GGATGTGTGCAGGGAGGGGCCGG - Intergenic
1141278360 16:82608063-82608085 GACCGGAAGCAGAGAGGGGAGGG + Intergenic
1142602296 17:1059619-1059641 GAATGTCTGGTGAGAGGGGGAGG - Intronic
1142654388 17:1381561-1381583 GAATGCATGTAAAGGGGGGAGGG + Intronic
1143914897 17:10283483-10283505 AGATGTATACAGAGAGGGAAAGG + Intergenic
1144397704 17:14861279-14861301 GAATGTATGAAGGGAGGACATGG - Intergenic
1144652375 17:17015065-17015087 GCACGTTTGCAGAGATGGGAAGG - Intergenic
1145833854 17:27938876-27938898 GAATGGATGCAGAGAAGCAAGGG + Intergenic
1145971761 17:28960407-28960429 GCATGGAGGCAGAGAGGGGTAGG + Intronic
1145984479 17:29036025-29036047 GCATCTCTGCAGAGAAGGGAGGG + Intronic
1146446090 17:32934085-32934107 GATTGGGTGCAGGGAGGGGAAGG + Intronic
1147393973 17:40127117-40127139 GAACGTATGGAAAGTGGGGAAGG + Intronic
1150408346 17:64921202-64921224 GAATGTATGGGGAGCGGGCAAGG - Intergenic
1150931141 17:69586765-69586787 GAATATATGAAGTGAGGGAAAGG + Intergenic
1150933347 17:69609557-69609579 GCATGTATGCCAAAAGGGGAAGG - Intergenic
1151011286 17:70499988-70500010 GATTGAATACAGAGAGGAGAAGG - Intergenic
1152093085 17:78257669-78257691 GAAGAACTGCAGAGAGGGGAGGG - Intergenic
1152471197 17:80490926-80490948 GAATGTTGGCAGGGAGGGGCGGG + Intergenic
1153476775 18:5505964-5505986 GAAGGTATGCAGAGAAGGGGTGG - Intronic
1154389719 18:13925956-13925978 GCATGTGCTCAGAGAGGGGAAGG - Intergenic
1155425576 18:25703196-25703218 GAATGTACAAAGAGAGGGAAGGG + Intergenic
1155522041 18:26678024-26678046 GAATCTATTCAGAGAAGGTAGGG - Intergenic
1155802272 18:30122771-30122793 GCATGTATGCAGAGTGGCTATGG - Intergenic
1157111719 18:44826728-44826750 GAATGAATTGGGAGAGGGGAAGG + Intronic
1157790773 18:50529073-50529095 GATTGAATGCTGAGAGCGGAAGG - Intergenic
1157997398 18:52575208-52575230 GAATGGATACAGAGAGAAGATGG - Intronic
1158273115 18:55738057-55738079 GAAGGTAAGAGGAGAGGGGAAGG - Intergenic
1158503895 18:58028826-58028848 AAATGGATGGAGAGAGAGGAAGG + Intergenic
1158564823 18:58545837-58545859 GAATGGCTGGAGAGAGGGGAAGG - Intronic
1160946542 19:1646422-1646444 GAACATCTGCAGGGAGGGGAGGG + Exonic
1161873327 19:6887521-6887543 GAAGGTGTGCGAAGAGGGGAAGG - Intergenic
1161982808 19:7638709-7638731 GAATTTCTGCAGGGAAGGGAGGG - Exonic
1162140797 19:8584732-8584754 AAATGCTTGCAGGGAGGGGATGG + Intronic
1163885319 19:19960075-19960097 TAATGTATCAAGAGAGGGGCTGG + Intergenic
1163934808 19:20433194-20433216 TAATGTATCAAGACAGGGGATGG + Intergenic
1163935748 19:20441608-20441630 TAATGTATCAAGATAGGGGATGG - Intergenic
1166304998 19:41932525-41932547 GAAAGCAGGCAGAGAGGGGCTGG + Intergenic
1166609090 19:44173095-44173117 GAATGTAAGAGGAGAGGGGTGGG - Intronic
925283729 2:2702663-2702685 GACTGCATGGAGAGATGGGATGG - Intergenic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363609 2:3296163-3296185 GTATGTGTGCAGGGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925372928 2:3360903-3360925 GAAAGTATGGGGAAAGGGGAGGG + Intronic
925958370 2:8992277-8992299 GAATGAATGGAGAGAGGTGCTGG - Intronic
926245995 2:11122845-11122867 GAAGGTATGGAGATGGGGGAGGG - Intergenic
926920730 2:17937390-17937412 GAAGGGATGGAGAGTGGGGAAGG - Intronic
926982016 2:18583015-18583037 GAATGTGTGTAAAGAGGGGCAGG + Intronic
928040620 2:27872892-27872914 GAATGGATGCAGAGGGGTAAAGG + Intronic
928409248 2:31041666-31041688 GAAGGTGAGCAGGGAGGGGAAGG + Intronic
929745526 2:44653604-44653626 GAAGGTATGCAGAGAAGGAGTGG + Intronic
930520725 2:52463521-52463543 GTGTGTATGCAGAGAGGTAAAGG + Intergenic
933059995 2:77725222-77725244 GAATGAATGAAGGGAAGGGAAGG + Intergenic
933143044 2:78817211-78817233 GAAAGTAAGCAAAGAAGGGAAGG + Intergenic
933779132 2:85789198-85789220 GTATGTATGCAGGAGGGGGATGG - Intergenic
934851749 2:97706337-97706359 GAGTGTGTCCTGAGAGGGGATGG + Intergenic
935123497 2:100202239-100202261 TCATGTATCCAGAGAGGGCAAGG + Intergenic
935713608 2:105920000-105920022 GAAATTATGCAGAGGAGGGATGG + Intergenic
936061524 2:109298198-109298220 AAATAGATGCAGAGAAGGGAAGG + Intronic
936591820 2:113811573-113811595 GAATGGAGCAAGAGAGGGGAGGG - Intergenic
937182190 2:120006739-120006761 GAATATTTGCAAAGAAGGGAAGG + Intergenic
937583385 2:123516612-123516634 AATTGGATGCAGAGAGGGAAGGG - Intergenic
939141743 2:138362241-138362263 GAATGTAGGAGGAGAGGGAAAGG + Intergenic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
940854515 2:158719271-158719293 GCATGGATTCAGAGAGGGGTGGG + Intergenic
940868202 2:158837783-158837805 GAAGGCATGCAGGGAGGGGAGGG + Intronic
942046711 2:172103095-172103117 GAATGTGAGCAGCGAGGCGAGGG + Intergenic
943370588 2:187010996-187011018 GGGTGTGTGCAGAGAGGGGAAGG - Intergenic
943485038 2:188468813-188468835 GGATGTTTGCAACGAGGGGAGGG + Intronic
943789745 2:191918690-191918712 GAATGTATGCAGAATTGGAAAGG + Intergenic
945601527 2:211871879-211871901 AAATGTATGGAGAGAGAGGGAGG + Intronic
945834836 2:214827259-214827281 GAAAGTATGCAGAAAAGGAAGGG + Intergenic
946135945 2:217646987-217647009 TAAGGAATGCAGAGAGAGGAAGG - Intronic
948117944 2:235507534-235507556 GATTTTATTCAGTGAGGGGAAGG - Intronic
948260209 2:236598866-236598888 GAATGGATGCAGGGAGATGATGG + Intergenic
1170286718 20:14718002-14718024 GAATGTATACAGAGATGGTGCGG + Intronic
1170464668 20:16611706-16611728 GAATGGATGAAGTGAGAGGAGGG + Intergenic
1171959351 20:31482704-31482726 GACTGTAGGCAGAGAGGGAAGGG - Intronic
1172806034 20:37612528-37612550 GAATGGAAGCAGAGAGGAGGTGG - Intergenic
1172891222 20:38266941-38266963 GAATGGAGACAGAGAGTGGAAGG + Intronic
1172903290 20:38350416-38350438 GGATGTATTGAGAGAGAGGAGGG + Intronic
1173132486 20:40407978-40408000 GGATGTTCTCAGAGAGGGGAAGG - Intergenic
1174150521 20:48483134-48483156 GAGGGTATGCAGCGAGGGAATGG + Intergenic
1174906285 20:54555396-54555418 GAATGTGGGGAGAGAAGGGAGGG + Intronic
1175490192 20:59375126-59375148 GAATGGAAGAAGAGAAGGGAAGG - Intergenic
1175617270 20:60411337-60411359 GTGTGGATGCAGAGAGGAGATGG - Intergenic
1177497155 21:21903862-21903884 GAAGGGATGGAGGGAGGGGAGGG + Intergenic
1177649155 21:23938351-23938373 GAGTGTCTTCAGACAGGGGAAGG - Intergenic
1178182803 21:30183300-30183322 GAATGTATGCAGAAAGGGCATGG + Intergenic
1179215394 21:39362781-39362803 GAAGGTATGAAGGGAGGTGATGG + Intergenic
1179245167 21:39626984-39627006 GAATGTGGGAAGAGATGGGAGGG - Intronic
1179881036 21:44293441-44293463 GAATTGAGGCAGGGAGGGGAGGG - Intronic
1180007735 21:45030973-45030995 GAAGGTTTGGAGAGAGGAGAAGG + Intergenic
1181423629 22:22818940-22818962 CAAAGGATGCAGAGAGGGGGAGG - Intronic
1182267095 22:29125491-29125513 GAATGAATACATAGAAGGGAGGG - Intronic
1182875461 22:33687678-33687700 GAAAGTGTGGAGAGATGGGAGGG + Intronic
1183007645 22:34916630-34916652 GGAGGGAGGCAGAGAGGGGAAGG + Intergenic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184345665 22:43911137-43911159 GAATGTAAGCTGAGAAAGGAGGG - Intergenic
949746566 3:7300631-7300653 GAATGCATGCAGAATTGGGAGGG - Intronic
950479505 3:13235776-13235798 CAGTGCCTGCAGAGAGGGGAGGG + Intergenic
950686297 3:14620836-14620858 GAGAGTAGGCAGGGAGGGGAAGG + Intergenic
950886619 3:16367971-16367993 GAAGGTGTGCAGAGAGGTGCTGG - Intronic
951114621 3:18845514-18845536 GAATGAAAGCAGAGGAGGGAAGG - Intergenic
951114625 3:18845539-18845561 GAATGAAAGCAGAGGAGGGAAGG - Intergenic
953531097 3:43740513-43740535 CAATGTGTGCAGAGTGGGAAAGG - Intergenic
955673565 3:61427247-61427269 GAATTAAGGGAGAGAGGGGAGGG + Intergenic
956285768 3:67608508-67608530 TAATGTGTGCAGGGAGTGGATGG - Intronic
956905685 3:73762826-73762848 GGATGTACACAGAGAGGGCATGG - Intergenic
956943232 3:74189033-74189055 GAAAGAATGGAGAGAGGAGAGGG - Intergenic
959044760 3:101461458-101461480 GAATGAAGGAAGAGAGGAGAAGG + Intronic
959473740 3:106784729-106784751 GCATGTATGCATAGGGGTGAAGG + Intergenic
959582779 3:107999264-107999286 GGAGGTTTGCAGAGAGAGGAAGG + Intergenic
959653730 3:108777699-108777721 GAAGGTGGGAAGAGAGGGGATGG + Intergenic
961974022 3:131003658-131003680 GCCTGTATCCTGAGAGGGGAGGG - Intronic
962186691 3:133267853-133267875 GAATGATTGAAGAGAGGGCAAGG + Intronic
963711464 3:148752416-148752438 GAAAGGATGCAGAGAAGGAAGGG - Intergenic
964242775 3:154616143-154616165 GCATGTTTGCAGAGGGGGCAGGG - Intergenic
966270748 3:178102298-178102320 GGCTGGATGCAGAGAGGGGTGGG + Intergenic
967344055 3:188433732-188433754 GAAGGTATGGAGAGACAGGAGGG + Intronic
967362240 3:188644726-188644748 GAATCTATGCTGAGAGGAGATGG + Intronic
969272785 4:6114157-6114179 GAATGAATGCAGAGCGAGGAGGG + Intronic
971345740 4:25810272-25810294 ACATGAAGGCAGAGAGGGGAGGG - Intronic
971372188 4:26028423-26028445 GATTTTACACAGAGAGGGGACGG + Intergenic
971372210 4:26028515-26028537 GATTTTATATAGAGAGGGGACGG + Intergenic
971372226 4:26028577-26028599 GATTTTATATAGAGAGGGGACGG + Intergenic
971372234 4:26028608-26028630 GATTTTATATAGAGAGGGGACGG + Intergenic
971372268 4:26028761-26028783 GATTTTATATAGAGAGGGGATGG + Intergenic
972643662 4:40947848-40947870 GGATGGATGGAGAGATGGGAGGG + Intronic
974106989 4:57480964-57480986 GAAGGAAGACAGAGAGGGGAGGG + Intergenic
978681750 4:111389216-111389238 GAACATATGCAGATAGGGAAAGG - Intergenic
979442629 4:120769474-120769496 GAATGTAAACAGTGAGGGGTCGG + Intronic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
979882751 4:125983258-125983280 GAAAGAAGGAAGAGAGGGGAGGG + Intergenic
979972555 4:127155004-127155026 CCATGGATGTAGAGAGGGGATGG - Intergenic
980710908 4:136566206-136566228 GAATGAATGCAGACTGGGCACGG + Intergenic
980819790 4:137999298-137999320 GAACTAATGCAGAAAGGGGATGG - Intergenic
981586337 4:146307180-146307202 GAGTGTATGCAGATTGGGGCTGG - Intronic
982081795 4:151797383-151797405 TAATGAATGCAAAGAGGTGATGG - Intergenic
985131172 4:186740234-186740256 GAATATAGGCAGAGAGTGGATGG - Intergenic
985158109 4:187014341-187014363 GGAGCTATGCAGACAGGGGAAGG + Intergenic
988801191 5:34698136-34698158 GAAGGGAGGCAGAGAGGGGAGGG - Intronic
988942230 5:36158241-36158263 GTCTGTTTGCAGAGAGCGGAAGG - Intronic
991509279 5:67359000-67359022 GAGAGTATGCACAGAGGAGATGG - Intergenic
991602304 5:68365845-68365867 GAATTTAGGAAGAGATGGGAGGG + Intergenic
992995240 5:82325924-82325946 GGATGGATGGAGAGAAGGGAAGG - Intronic
993026563 5:82653799-82653821 GAATCTATGCACTTAGGGGAAGG - Intergenic
993884089 5:93396387-93396409 GAATTTATGGAGAGAAAGGAGGG - Intergenic
994778480 5:104064165-104064187 GTATGTATGGAGAGAGAGAATGG + Intergenic
995143788 5:108763594-108763616 AAATGTTTCCAGGGAGGGGAAGG + Intronic
995683066 5:114742403-114742425 AAATGAATTCATAGAGGGGAAGG - Intergenic
996087964 5:119323380-119323402 GTATGTATGCAGGGTGGGGTGGG - Intronic
996739856 5:126788857-126788879 GAATGTTGGCAGTGAAGGGAAGG + Intronic
997425482 5:133799956-133799978 GGATGTATGCTGAGAGAGAAGGG - Intergenic
997559464 5:134833435-134833457 AAATGTATGTAGAGGGGTGAGGG + Intronic
997724699 5:136110719-136110741 GAGTGTAAGCAGAGAGCTGATGG + Intergenic
998435504 5:142104821-142104843 GGATGTACCCAGAGAGGGAAAGG - Intergenic
999007732 5:148001381-148001403 GAATGGATTGAGAGAGGGCAAGG + Intergenic
999375843 5:151085950-151085972 GAATGGAGGGAGAGCGGGGAGGG - Intronic
1000388373 5:160697587-160697609 AAATGTATGCAGGGTGGGGTGGG + Intronic
1000802771 5:165749264-165749286 GAAGGTATACAGGGTGGGGAAGG - Intergenic
1001134267 5:169089552-169089574 GAGTGTAGGCAGAGAGTGCACGG - Intronic
1002427575 5:179185300-179185322 GGATGAGTGCAGAGAAGGGACGG + Intronic
1002982052 6:2147636-2147658 GCATGTATGTGGAGAGGGGAGGG - Intronic
1002987019 6:2200370-2200392 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987029 6:2200450-2200472 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987047 6:2200610-2200632 GCATGTTAGCAGAGAGGCGAAGG + Intronic
1002987055 6:2200690-2200712 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987064 6:2200770-2200792 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987074 6:2200850-2200872 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987112 6:2201170-2201192 GCATGTTAGCAGAGAGGTGAGGG + Intronic
1002987121 6:2201253-2201275 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987129 6:2201333-2201355 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987136 6:2201413-2201435 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987143 6:2201493-2201515 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987153 6:2201573-2201595 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987162 6:2201653-2201675 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987172 6:2201733-2201755 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987181 6:2201813-2201835 GCATGTTAGCAGAGAGGCGAAGG + Intronic
1002987202 6:2201973-2201995 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987220 6:2202133-2202155 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987229 6:2202213-2202235 GCATGTTAGCAGAGAGGTGAAGG + Intronic
1002987238 6:2202293-2202315 GCATGTTAGCAGAGAGGCGAAGG + Intronic
1005277757 6:24238165-24238187 GAATGGAGGGAGGGAGGGGAGGG + Intronic
1005585605 6:27273494-27273516 GAATGATTGGAGAGAGGGGGAGG + Intergenic
1005712491 6:28515415-28515437 GAATGTATGTGGAGTGGGGTTGG - Intronic
1006649128 6:35536446-35536468 GCATGCATACAGAGAGGAGAGGG + Intergenic
1006852906 6:37112233-37112255 GAATGGCTGGAGTGAGGGGATGG - Intergenic
1007599943 6:43075495-43075517 CAAGATATGCTGAGAGGGGATGG - Intergenic
1007728179 6:43929487-43929509 GAATACATGTAGTGAGGGGAGGG + Intergenic
1008663467 6:53693463-53693485 CAATGTATGTAGAGAGGGTGTGG + Intergenic
1010824468 6:80455678-80455700 GAAAACATGCAGAGAGGGAAGGG - Intergenic
1011477549 6:87762832-87762854 GAATGTATGGAGAGAGAAGTTGG - Intergenic
1011615389 6:89193269-89193291 GAATGAATGAAGTGAGGAGATGG + Intronic
1013301102 6:108805516-108805538 AAATGTTTGCAGTGAGGAGAGGG + Intergenic
1013332631 6:109120470-109120492 GATTATCTTCAGAGAGGGGAAGG + Intronic
1013634623 6:112017261-112017283 GAATGTATGAGGAAAGGAGATGG - Intergenic
1014283301 6:119465814-119465836 GAATGTATGTATGGAGCGGAGGG + Intergenic
1016278064 6:142378648-142378670 GAAAGGAAGCAGAGAGAGGAAGG - Intronic
1017873534 6:158505241-158505263 GAATTTAAGTAGAGAGGGGAGGG - Intronic
1019934214 7:4243802-4243824 GATTCTCTGCTGAGAGGGGAAGG + Intronic
1022104574 7:27188924-27188946 GTGTGTCTGCAGAGAAGGGAGGG + Intergenic
1022729268 7:33007340-33007362 GAATGGGGGCACAGAGGGGATGG - Intergenic
1025044387 7:55680640-55680662 GAATGGGGGCACAGAGGGGATGG + Intergenic
1025049588 7:55723128-55723150 GAATGTGTGCAGAGGGAGGTGGG - Intergenic
1026526340 7:71156639-71156661 GAAGGGAGGCAGGGAGGGGAAGG - Intronic
1026827138 7:73591530-73591552 GTATGCATGCAGAGAGTGGATGG - Intergenic
1027357350 7:77370925-77370947 GAATGTCTGGAGAGAGAGAAAGG - Intronic
1028689308 7:93633724-93633746 GAAAGTAAGCAGGGAGGGGGTGG + Intronic
1029590971 7:101506871-101506893 GGATGTGTGCAGGGAGGAGAAGG - Intronic
1030199597 7:106889181-106889203 GAGAGTAAGCAGAGAGGGGTTGG - Intronic
1030552675 7:110983764-110983786 GAATGTATGTGGACAGAGGAGGG - Intronic
1030840466 7:114346777-114346799 GACTGGATGGAGAGAGGGGAAGG + Intronic
1030903495 7:115153060-115153082 GAATCTGTTCAGAGATGGGAGGG - Intergenic
1030983420 7:116211666-116211688 GAAGTTTTGCAGAGAGAGGAAGG + Intronic
1031427093 7:121618075-121618097 GAATGTATGCAGACATTTGAAGG - Intergenic
1031483601 7:122304888-122304910 GAGTGTGTGCGCAGAGGGGAGGG - Intronic
1031513629 7:122677015-122677037 GAATGTACGCAGAGTGTGGAGGG - Intronic
1032333878 7:131006329-131006351 GAATGGAGGTAGAGAGGGGTAGG + Intergenic
1032645962 7:133824324-133824346 AAATGTGGGCAGAGAGGGCAGGG - Intronic
1032745932 7:134786014-134786036 GAATCTAAGCTCAGAGGGGAGGG + Intronic
1032803793 7:135336956-135336978 GAATGAATGCAGAAAGGCCAGGG + Intergenic
1032991127 7:137396031-137396053 AAATGTATGCACAGAGAGAATGG - Intronic
1033232884 7:139615271-139615293 AGATGTATGCAGAGAGGGAGAGG + Intronic
1033724609 7:144101202-144101224 GAATCCATGCAGAGGAGGGAAGG - Intergenic
1034270478 7:149801226-149801248 GAATGGATGAATAGAGGGGTGGG - Intergenic
1034299377 7:150001813-150001835 GCATGCATGCAGAAAGGAGATGG + Intergenic
1034329192 7:150268461-150268483 GAGTGTATTCAGAGGGCGGAAGG - Intronic
1034385763 7:150739705-150739727 GAAAGAAAGGAGAGAGGGGAGGG + Intronic
1034606817 7:152323792-152323814 GAAGGGAGGCAGGGAGGGGAGGG + Intronic
1034668862 7:152841399-152841421 GAGTGTATTCAGAGGGCGGAAGG + Intronic
1034806634 7:154094960-154094982 GCATGCATGCAGAAAGGAGATGG - Intronic
1034947514 7:155272763-155272785 TAATGTATTCAGAGATGTGAGGG + Intergenic
1035544275 8:467671-467693 GAAGGAATGCAGTGAAGGGAGGG - Intronic
1036182636 8:6598325-6598347 GAACTCATGCAGGGAGGGGAGGG + Intronic
1036751857 8:11448711-11448733 CAATGTGAGCAGAGAGGGAAGGG - Intronic
1037204781 8:16303506-16303528 AAAGGAAAGCAGAGAGGGGAAGG - Intronic
1037415538 8:18645931-18645953 GAGTGTGTGCAGAGAGAGGTAGG - Intronic
1037431031 8:18813389-18813411 GAATTCTTGCAGACAGGGGATGG - Intronic
1038166551 8:25090578-25090600 GAGTGCGTGCAAAGAGGGGAAGG + Intergenic
1039052797 8:33510221-33510243 GAAGGTATGTTGAGAAGGGAGGG + Intronic
1039414704 8:37383885-37383907 GCATGTATGCATAAAGGAGATGG - Intergenic
1041535795 8:58924321-58924343 GTATGTATGGAGAGAGGGGATGG - Intronic
1042950872 8:74199516-74199538 GAATGTTTGCTGAGTGGGTAAGG + Intergenic
1043010403 8:74874720-74874742 GTATGTGTGCAGGGAAGGGAGGG - Intergenic
1043406744 8:79943720-79943742 GAATGTATGCAGAGAGGGGAGGG - Intronic
1043417281 8:80064015-80064037 GAAGGAAGGGAGAGAGGGGAGGG + Intronic
1043595149 8:81877025-81877047 CAAAGTATGCAGTGAGGAGATGG - Intergenic
1043960580 8:86413475-86413497 GAATACATGCAGAGAAGGAATGG + Intronic
1045071282 8:98507030-98507052 GAGTATATGTAGAGAAGGGAAGG - Intronic
1045214898 8:100138613-100138635 GTATGTTTGGAGAGATGGGAAGG + Intronic
1046277149 8:111977960-111977982 AAAGGTATGCAGATATGGGAGGG - Intergenic
1046381949 8:113462966-113462988 GAATATATGCATAGAGAGAAAGG - Intergenic
1047987996 8:130256429-130256451 GAATGAATTCAGAGTGGTGATGG - Intronic
1048322062 8:133407735-133407757 GAATGTATGCAAAGGGAGGCAGG + Intergenic
1048640254 8:136349899-136349921 GGATGTATGCAGTGAGTAGATGG - Intergenic
1049599397 8:143500032-143500054 GAGTGTTTGCAGAGAGGATAGGG - Intronic
1049616860 8:143579289-143579311 GAATGAATGAGGTGAGGGGAGGG + Intergenic
1049794986 8:144493140-144493162 GTATGTAGGCAGTGAGGGGACGG + Intronic
1050540109 9:6662355-6662377 GAATTTAGGCATAGAGGGCAGGG - Intergenic
1051714198 9:19964535-19964557 GAAAGGATACAGAGAGGAGATGG + Intergenic
1053270935 9:36749083-36749105 GAGAGTATGAAAAGAGGGGAAGG + Intergenic
1056859111 9:90163245-90163267 GAATGGAGGGGGAGAGGGGAGGG + Intergenic
1058400111 9:104605843-104605865 GAGTGAATGGAGAGAGGGAAGGG + Intergenic
1058419290 9:104819320-104819342 GAATGGAAGCGGAGAGGGGCAGG - Intronic
1059235207 9:112755111-112755133 AAATGTATCCAGTGAGGGCAGGG - Intronic
1059440548 9:114304454-114304476 GACTGTCTGCAAAGAGAGGAAGG + Intronic
1059452269 9:114377790-114377812 GCCTGTATGCATAGAGGGGATGG - Intronic
1059993916 9:119891234-119891256 GAAGGGCTGCAGAGAGAGGACGG - Intergenic
1060810903 9:126611126-126611148 GAATGAATGGACAGCGGGGAAGG + Intergenic
1061245038 9:129397268-129397290 GAATGTATGGAAAGATGGGTGGG + Intergenic
1187106805 X:16251713-16251735 GAAGGTTTGCAGAGAGAAGAGGG + Intergenic
1187373009 X:18725947-18725969 GAAGCTAGGCAGAGATGGGAGGG + Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189242369 X:39535281-39535303 GAATTGAGGCAGGGAGGGGAAGG - Intergenic
1189647373 X:43148127-43148149 GAATGTATGTAGAGAAGGGATGG + Intergenic
1189687987 X:43586063-43586085 AAATGTGTGTGGAGAGGGGAAGG - Intergenic
1189865629 X:45324232-45324254 GAAAGCATAGAGAGAGGGGAAGG - Intergenic
1190214766 X:48472671-48472693 GAATGGATGCAGAGGGGAGGGGG - Intergenic
1190525101 X:51321361-51321383 GAGTGTAGGCAGAGAAGAGAAGG + Intergenic
1190622158 X:52298331-52298353 GAATGAATGGAGAGAGGGAGAGG - Intergenic
1193650154 X:84122216-84122238 GAGTCTTTGCAGATAGGGGAGGG + Intronic
1193834360 X:86323516-86323538 CATTGCATACAGAGAGGGGATGG + Intronic
1193871402 X:86803464-86803486 GAATGAAGGAAGAAAGGGGATGG - Intronic
1194026263 X:88755039-88755061 GCATGTATGTATGGAGGGGAAGG - Intergenic
1194645148 X:96450302-96450324 GAATATATGAAGAAATGGGATGG + Intergenic
1195123444 X:101780678-101780700 GAAAGTTTGCACAGAGGGCAAGG + Intergenic
1196045079 X:111248478-111248500 GAATGTCTGAAGAGGGGAGACGG + Intronic
1196813578 X:119647338-119647360 GAATGGAGGAAGGGAGGGGAGGG - Intronic
1199471012 X:148196635-148196657 GAATGAATTTAGAGAGTGGATGG + Intergenic