ID: 1043413481

View in Genome Browser
Species Human (GRCh38)
Location 8:80024510-80024532
Sequence CTTTGTAAGGATAATGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043413479_1043413481 -3 Left 1043413479 8:80024490-80024512 CCTGGCTGCAGGGGAAAGTTCTT 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1043413481 8:80024510-80024532 CTTTGTAAGGATAATGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043413481 Original CRISPR CTTTGTAAGGATAATGTGTA TGG Intronic
No off target data available for this crispr