ID: 1043415890

View in Genome Browser
Species Human (GRCh38)
Location 8:80048582-80048604
Sequence GGGTAGTTCTTGAGGGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043415884_1043415890 -5 Left 1043415884 8:80048564-80048586 CCTAAGCTCCCTTTCCTTGGGTA 0: 1
1: 0
2: 3
3: 20
4: 198
Right 1043415890 8:80048582-80048604 GGGTAGTTCTTGAGGGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043415890 Original CRISPR GGGTAGTTCTTGAGGGAACG TGG Intronic
No off target data available for this crispr