ID: 1043417931

View in Genome Browser
Species Human (GRCh38)
Location 8:80070674-80070696
Sequence ACCTGGGCGTTGGGGATCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043417916_1043417931 26 Left 1043417916 8:80070625-80070647 CCTGCCACTCACTGGTTCCTAAC 0: 1
1: 0
2: 2
3: 13
4: 141
Right 1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG No data
1043417922_1043417931 0 Left 1043417922 8:80070651-80070673 CCACAGATGGGTACCAGTCCACC 0: 1
1: 1
2: 8
3: 38
4: 290
Right 1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG No data
1043417918_1043417931 22 Left 1043417918 8:80070629-80070651 CCACTCACTGGTTCCTAACAGGC 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG No data
1043417921_1043417931 9 Left 1043417921 8:80070642-80070664 CCTAACAGGCCACAGATGGGTAC 0: 6
1: 36
2: 218
3: 638
4: 1033
Right 1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043417931 Original CRISPR ACCTGGGCGTTGGGGATCCC TGG Intronic
No off target data available for this crispr