ID: 1043424310

View in Genome Browser
Species Human (GRCh38)
Location 8:80133445-80133467
Sequence ATCTGGTTTTGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 375}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043424310_1043424315 4 Left 1043424310 8:80133445-80133467 CCTTCTTCCCTCCAAAACCAGAT 0: 1
1: 0
2: 1
3: 35
4: 375
Right 1043424315 8:80133472-80133494 TTTCCTCTTTGTGTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043424310 Original CRISPR ATCTGGTTTTGGAGGGAAGA AGG (reversed) Intronic
900200220 1:1401360-1401382 AGCTGCCTTTGGAGGGGAGACGG + Intronic
900511615 1:3063506-3063528 ATTTGGTTTTGAAGCTAAGAGGG + Intergenic
902688858 1:18097035-18097057 ATTGGGTTTTGGAGGGCAGAAGG - Intergenic
903692139 1:25181995-25182017 ATCTTGATTTGGATGGAAGGTGG - Intergenic
904926492 1:34053025-34053047 AAGTGGCTTTGGAAGGAAGAGGG + Intronic
905016560 1:34782156-34782178 AGCTGGCTTTGGAGGGCAGCTGG + Intronic
905652638 1:39666772-39666794 ATCAGGTTTGGGAGGGGAGAAGG - Intronic
905910013 1:41647280-41647302 ATGGGGTTTTGGAAGGAAGGTGG + Intronic
905912476 1:41663591-41663613 ATCTGGCTTTGGAGGAAGGGTGG - Intronic
907159811 1:52361709-52361731 CTCTGCTGTGGGAGGGAAGAGGG - Intronic
911434363 1:97837080-97837102 TTCTGGTTTTGGAGGAATAAAGG + Intronic
912155131 1:106908951-106908973 AGCTGGCTAGGGAGGGAAGAGGG + Intergenic
912261948 1:108119623-108119645 AGCTGGGCTTGAAGGGAAGAAGG - Intergenic
914345174 1:146793008-146793030 ACCTGGGTTTGCATGGAAGATGG - Intergenic
914431002 1:147620179-147620201 AACTGGTATTCGAGGGAAAATGG - Exonic
914863251 1:151404041-151404063 GTCATGTTTTGGAGGGAAGGTGG + Exonic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
917108619 1:171521322-171521344 CTATGATTTTGAAGGGAAGAAGG - Intronic
917979893 1:180262559-180262581 AACTTTTTTTGGTGGGAAGAGGG + Intronic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
918060272 1:181055237-181055259 ATCTGGTGTTGGAAGGTAGATGG - Exonic
918135045 1:181664570-181664592 AGCTGCTTTTGGGGGGAAAAAGG + Intronic
922627264 1:227061213-227061235 GTTTGGTTTTGGGGGCAAGAAGG - Intronic
923031788 1:230255048-230255070 ATCAGGTTCTGGAAGGAGGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923591985 1:235327818-235327840 TGCTGGTTTTGGGGGGGAGAAGG - Exonic
923747537 1:236716415-236716437 ATCTGGTTTTGGCAGGAAATAGG + Intronic
923822442 1:237460053-237460075 AGCTGGTTCTGGAGATAAGATGG - Intronic
924056090 1:240125812-240125834 ATCTTATTTTGGAGGGCAGCTGG + Intronic
1063083400 10:2790110-2790132 GTGTGGTTTTGGAGGGATGGTGG - Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066359869 10:34719681-34719703 ATGTCCTTTTGGAGGGGAGAAGG - Intronic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068060684 10:52064335-52064357 TTCTGATTTTGGAGGAAAGTTGG - Intronic
1069380360 10:67838030-67838052 CTCTTGTTTCCGAGGGAAGAAGG - Exonic
1069689859 10:70343334-70343356 ATGTGGTTTTGGGGGGGAAAAGG + Intronic
1069855259 10:71436812-71436834 ATCTGGTTTGGAATGGCAGAGGG + Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070496418 10:77028053-77028075 ATCAGGTTTAATAGGGAAGATGG - Intronic
1071595345 10:86918338-86918360 ACCTTTTTCTGGAGGGAAGAGGG + Intronic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072188881 10:93064953-93064975 AGGTGATTTTGGAAGGAAGAAGG - Intronic
1072564972 10:96609866-96609888 GTCTGGAATTGGAGGAAAGAGGG + Exonic
1073345016 10:102776436-102776458 ATCGGGTTTGGAAGGGAAGAAGG + Intronic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074764542 10:116691114-116691136 ATCTGTTTTTATAGGGATGAAGG - Intronic
1075206600 10:120454657-120454679 AAGTGGTTTTGGAGGGCAAAAGG - Intergenic
1075456483 10:122588324-122588346 TTCTGGTGTTGGAGGGTAGAGGG + Intronic
1076289111 10:129330595-129330617 ATTTGATTTGGGAGGAAAGAAGG - Intergenic
1077587064 11:3461989-3462011 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1077941091 11:6844321-6844343 ACCTGTTTCTGGAGGAAAGAAGG - Intergenic
1078407024 11:11079332-11079354 ATCTGGTTTTGCAGACAAGTTGG + Intergenic
1079088577 11:17464813-17464835 ATCTGGTCTAGGAGGGAGGAGGG - Intronic
1079322559 11:19463755-19463777 ACAAGGTTTTGGAGGCAAGAGGG + Intronic
1079531354 11:21458061-21458083 ATCTGGCTGTGAAGAGAAGAAGG + Intronic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1084829930 11:71760941-71760963 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1085017678 11:73185901-73185923 ATCGGGTTGTGGATGGAGGAAGG + Intergenic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085340514 11:75728196-75728218 ATTTTATTTTGGTGGGAAGATGG + Intronic
1085421926 11:76370140-76370162 GTTAGGTTTTGGGGGGAAGAGGG - Intronic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1088403500 11:109446339-109446361 ATCTGGTTTTGAAGGCAAACAGG + Intergenic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1089920863 11:122208139-122208161 TTCTGGCTTTGGGAGGAAGATGG + Intergenic
1092413305 12:8270736-8270758 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1092901601 12:13064873-13064895 ATCTGGGTTTAGAGTGAAGTGGG + Intronic
1093980381 12:25469312-25469334 GCCTGGTCTTGGAGGGCAGAGGG + Intronic
1095528553 12:43157439-43157461 ATCTGGAAATGGAGGGAAGGTGG + Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098933584 12:76450789-76450811 TTTTGTTTTTGGAGGGGAGAAGG - Intronic
1099842371 12:87982025-87982047 ATCTGGTATGGGAGGTGAGAAGG + Intronic
1101776127 12:107795648-107795670 ATCAGAGGTTGGAGGGAAGAGGG + Intergenic
1101944951 12:109129702-109129724 AACTGCTTTTGGGGGGCAGAGGG - Intronic
1102033938 12:109760346-109760368 CTCCGGTTATGGAGGAAAGAGGG + Intronic
1102053187 12:109878186-109878208 GGCTGGTTTTGGAGGAAAGAGGG - Intronic
1102827695 12:115963420-115963442 ACGTGGTTTTGGAGTCAAGAGGG + Exonic
1104086914 12:125483923-125483945 GCCTGGTTTGGGAGGGAGGAAGG + Intronic
1106101597 13:26698139-26698161 GGCTGGCTTTGGAGAGAAGAGGG - Intergenic
1106848173 13:33760260-33760282 ATCTGGTTTTAGAGAGAAAGAGG + Intergenic
1107549031 13:41457940-41457962 AGCTGGTGGTGGAGGGAAGGTGG - Intronic
1108000911 13:45904913-45904935 GGCTGGTCTGGGAGGGAAGAAGG - Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1110047590 13:70849916-70849938 TGCTGGTTTTTGAGGGAATAGGG + Intergenic
1110192126 13:72742242-72742264 TTCTGGTTTTGGGGGGAGGGGGG + Intronic
1110884282 13:80613786-80613808 TTCTTTTCTTGGAGGGAAGATGG + Intergenic
1111993627 13:95140777-95140799 ATATGGATTTGGAGGAAAAAGGG - Intronic
1112707790 13:102091549-102091571 GGCTGGTATTTGAGGGAAGAAGG - Intronic
1112852936 13:103729183-103729205 ATCTGGTTTTGTAAGAGAGAAGG + Intergenic
1113056681 13:106275601-106275623 TTCTGGGTTAGGAGGCAAGAAGG - Intergenic
1114449331 14:22814631-22814653 AGCTGAAATTGGAGGGAAGACGG - Intronic
1114462527 14:22896295-22896317 AGCTAGTTTGTGAGGGAAGAGGG + Intergenic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1115519960 14:34223536-34223558 CTCTAGTTTTGGAGGGAGGCAGG - Intronic
1116829142 14:49700634-49700656 ATATGGATTTAAAGGGAAGAAGG + Intronic
1117076089 14:52106171-52106193 ATTGGGTTTTGGTAGGAAGAGGG - Intergenic
1118784978 14:69038332-69038354 ATCTGATTTCAGAGGGACGAGGG - Intergenic
1119099635 14:71867998-71868020 ATCTGGATATGGATGGATGATGG - Intergenic
1120512075 14:85427122-85427144 ATCTGGGTTGGGAGAAAAGAGGG - Intergenic
1121331524 14:93052704-93052726 ACCTGGGTTTGGAGGGAGGGTGG - Intronic
1122777985 14:104131251-104131273 ATCCCGTGTTGGAGGGGAGAGGG + Intergenic
1125301604 15:38260206-38260228 TACTGGTTTTAGAGGGAACATGG - Intronic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1128877566 15:71214865-71214887 GTCGGTTTTTGGAGGAAAGAGGG - Intronic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1129162572 15:73754742-73754764 AATTGGTTTTGGAGGGTAGAAGG + Intergenic
1129331482 15:74830115-74830137 GTCTCGTTCTGAAGGGAAGAGGG - Exonic
1129426460 15:75467047-75467069 AGCTGGTCTGGGAGGGATGAGGG - Exonic
1130445634 15:83998739-83998761 ATCCCTTTTTGGAGGCAAGAAGG - Intronic
1133354516 16:5126241-5126263 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1134344735 16:13379258-13379280 ATCTTATTTTGGAAGGAAGTGGG + Intergenic
1134486630 16:14663705-14663727 ACCTTTTTTTGGAGGGAGGAGGG + Intronic
1137024569 16:35459734-35459756 ATCTGGACTTGGAGGCACGAAGG + Intergenic
1137714091 16:50587226-50587248 TTCTGATTTTGTAGGGTAGATGG + Intronic
1139201741 16:64984419-64984441 ATCTTGTTTTGGAGGGAGGAAGG - Intronic
1139594738 16:67951052-67951074 ATCTGTTTTTGGAGGCATCATGG - Exonic
1139694221 16:68662081-68662103 ATCTAGTTTGGGAGGGTTGAGGG + Intronic
1139707255 16:68749750-68749772 ACCTGGTTTTGGAAGGAGAAAGG - Intronic
1139905226 16:70360686-70360708 AGCTGGCTTTGGAAGGAACATGG + Intronic
1139988820 16:70922284-70922306 ACCTGGGTTTGCACGGAAGATGG + Intronic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1140219559 16:73033706-73033728 ATTTGGGTTTGGAGGGAGGGAGG - Intronic
1140727211 16:77824303-77824325 AGCTGGTTCTGGAGAGGAGAGGG + Intronic
1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG + Intronic
1141839407 16:86565345-86565367 GTCTGGTTGGGCAGGGAAGAGGG - Intergenic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1142789756 17:2254939-2254961 AGTTGGTTTTGGAGAGGAGAGGG + Intronic
1143315756 17:6032214-6032236 AGCTGGTCATGGAAGGAAGAAGG - Intronic
1146206461 17:30909169-30909191 AGCTAGTTTTTGGGGGAAGACGG - Intronic
1146908585 17:36633452-36633474 ATCTGTTCTTCGAAGGAAGAGGG - Intergenic
1147178617 17:38671845-38671867 ACCTCGTTTTCGGGGGAAGAGGG + Exonic
1147558909 17:41497085-41497107 GTCGGGTTCTGGAGGGAGGAGGG - Intergenic
1148009719 17:44467675-44467697 ACCTGCTTTTGGAGGAAAAAAGG + Intronic
1149155663 17:53626851-53626873 GTCTGGTTGTGGAGGAAATAGGG + Intergenic
1149287972 17:55187172-55187194 AACTGGTTTTGCAGAGAAGTAGG + Intergenic
1149753290 17:59166267-59166289 ATCTGAGTTTGAAGGGAAGGAGG + Intronic
1150319064 17:64195299-64195321 ATCTGGATTTGGAGGAAAAATGG + Intronic
1151136520 17:71951095-71951117 ATTTTGTTTTGGAAGGAAAAGGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1153280378 18:3409166-3409188 ATCAGGCTTAGGTGGGAAGATGG + Intergenic
1153864319 18:9249590-9249612 ATCTGTTGTGGGAAGGAAGACGG - Intronic
1154027657 18:10723820-10723842 ATCTGCTTTTGGGGAGCAGAGGG - Intronic
1154137656 18:11794561-11794583 GCCAGGTGTTGGAGGGAAGAGGG + Intronic
1154375278 18:13803851-13803873 ATCTGGTTTGGGATGCAGGAAGG - Intergenic
1154378022 18:13824719-13824741 ATCTGAGTTTGGAGGGCAAAGGG + Intronic
1154450596 18:14473036-14473058 TTCTGGTTTTGGAGGGGCCAAGG - Intergenic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1159090888 18:63847744-63847766 ATTAGGTTTTGGAGGCAACAAGG + Intergenic
1159553759 18:69923632-69923654 ATCTGATTTAGGATGGAAAAAGG + Intronic
1161529854 19:4781683-4781705 ATCTGGCTGGGGAGGGAAGGAGG - Intergenic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163936755 19:20453357-20453379 ATCTGAATTTGTAGTGAAGAGGG + Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164799579 19:31065194-31065216 TTCTGGTTTGGGAGACAAGAAGG + Intergenic
1165351267 19:35277281-35277303 TATTGGTTTTGGAGGAAAGAGGG + Intronic
1166439294 19:42797294-42797316 ATGAGATTTGGGAGGGAAGATGG - Intronic
1166494923 19:43293617-43293639 ATGAGATTTGGGAGGGAAGATGG - Intergenic
1168127393 19:54293374-54293396 AGCAGGTGCTGGAGGGAAGAGGG + Intergenic
1168172964 19:54601474-54601496 AGCAGGTGCTGGAGGGAAGAGGG - Intronic
1168292955 19:55365967-55365989 ATCTGGCTTTGGAAGGACGGTGG + Exonic
925811323 2:7703647-7703669 ATCTGGTTTTGGGTGGATGGAGG + Intergenic
926776720 2:16430558-16430580 ATCACATTTTGGAGGGCAGATGG - Intergenic
927457023 2:23261680-23261702 ATCTGTGTTTGGAGTGAAGGTGG + Intergenic
929122329 2:38493889-38493911 ATCTGGGATAGGAGGGGAGAGGG + Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929247131 2:39714427-39714449 ATCAGGTTTCTGAGGCAAGATGG + Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929945538 2:46369012-46369034 ATCTGGTTTTGATGGGAAGTGGG - Intronic
930643272 2:53876629-53876651 ATCTACTTTTGGAGGACAGAAGG - Intronic
931781503 2:65582682-65582704 ATCTGGGTTTCGTAGGAAGAAGG + Intergenic
932160445 2:69455011-69455033 ACCTGGCTTTGGAGGTAAAAGGG - Intergenic
932214681 2:69959040-69959062 AGCTGGAATCGGAGGGAAGAAGG + Intergenic
932912067 2:75817045-75817067 ATCTGACTTTGGAGGAAAGGTGG - Intergenic
933536385 2:83580285-83580307 TGCTTATTTTGGAGGGAAGAAGG - Intergenic
933916289 2:86997222-86997244 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
934006704 2:87772683-87772705 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
934654127 2:96108573-96108595 AGCTGCTTTAAGAGGGAAGAGGG - Intergenic
935770351 2:106413604-106413626 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
935967860 2:108499212-108499234 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936131519 2:109847469-109847491 ATTTGGGGTTGGAAGGAAGAGGG - Intronic
936213178 2:110524016-110524038 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936283523 2:111163005-111163027 ATCTTGTTATGGAAGGAAAAGGG + Intronic
936422317 2:112378573-112378595 ATTTGGGGTTGGAAGGAAGAGGG + Intronic
936562766 2:113556065-113556087 GTCTGGCTTTGGCTGGAAGAAGG - Intergenic
936695863 2:114947543-114947565 ATCTTGTTTTGGAATGAGGATGG - Intronic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937392706 2:121504787-121504809 ATCTGGGCTTGGTGGAAAGATGG - Intronic
937979384 2:127605754-127605776 AACTGGTTTGGAAGGGAACAGGG - Intronic
938644776 2:133319260-133319282 ATCTCATTTTTGAGGGTAGAGGG + Intronic
938740975 2:134231980-134232002 AGCTGGTTTGTGAGGGAGGATGG - Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940834653 2:158507554-158507576 CTCTGCTTTTGGAGGGAGAATGG + Intronic
940910038 2:159202426-159202448 TACTGGTTTTGGAGAGCAGAGGG + Intronic
941480849 2:166009718-166009740 ATCTCGATTTGAAGGGATGAGGG - Exonic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
941563300 2:167076739-167076761 ATCTACTTTTGCAGGGAAAAGGG + Intronic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
942660184 2:178255708-178255730 ATCTGGGTTTGGAGGAATGTTGG + Intronic
942828064 2:180204423-180204445 AACTGGTTTGAGAGGGAAGGCGG + Intergenic
943018679 2:182546397-182546419 ATCTGCTGTGGGAGGAAAGAAGG + Intergenic
945493733 2:210484835-210484857 ATCAGTTTTTCCAGGGAAGAAGG - Intronic
946200212 2:218067260-218067282 ATATGGATTGGGAGGGCAGAAGG - Intronic
946855830 2:223948840-223948862 AGCAGGTTTGGAAGGGAAGAAGG + Intergenic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
947116632 2:226778686-226778708 ATTGGGTGTTGGAGGGAACAGGG - Intronic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
1169649091 20:7846823-7846845 ATCTGGTTTTGGTGGAAGAAGGG - Intergenic
1169778048 20:9277505-9277527 ATCTGGCATTGGAGGTCAGATGG - Intronic
1170905798 20:20514474-20514496 ATCTGGATGTGGAGTGGAGAGGG - Intronic
1171147126 20:22794736-22794758 AGCTGATTATGGAGGGAAAAGGG + Intergenic
1171254623 20:23680088-23680110 GCCTGGTTGTGGAGTGAAGAGGG + Intergenic
1171261105 20:23735361-23735383 GCCTGGTTGTGGAGTGAAGAGGG + Intergenic
1172509964 20:35493670-35493692 GCCTGGTTTGGGAGGGTAGATGG + Intronic
1173558107 20:43982436-43982458 AGCTGCTTTTAGAGAGAAGACGG + Intronic
1173988721 20:47283161-47283183 ATCATGTTTTGGAGGGACTATGG + Intronic
1174331875 20:49826541-49826563 ATGTGCTTTTGGAGTGCAGATGG - Intronic
1174378254 20:50140324-50140346 ATCTGATGCTGCAGGGAAGATGG - Intronic
1174898018 20:54471224-54471246 CTCTCATTTTGGAGGCAAGATGG + Intergenic
1174977952 20:55355800-55355822 ATCTGCATTTGGAGAGAAGTGGG - Intergenic
1176445599 21:6817346-6817368 TTCTGGTTTTGGAGGGGCCAAGG + Intergenic
1176823766 21:13682379-13682401 TTCTGGTTTTGGAGGGGCCAAGG + Intergenic
1178339600 21:31774791-31774813 ATCTGGTTTTACAGGGACCAAGG + Intergenic
1179383484 21:40920753-40920775 TTTGGATTTTGGAGGGAAGATGG + Intergenic
1181443841 22:22953261-22953283 ACCTGGTCTTGGAGTGATGAGGG + Intergenic
1182163896 22:28152337-28152359 ATCTTCTTGTGGATGGAAGAAGG + Intronic
1183658003 22:39201514-39201536 AGCTGGGCTTGGAGGGAAGTGGG + Intergenic
1183834896 22:40444097-40444119 ATCTGGTTCAGTAGGGAAGGTGG - Intronic
1184630147 22:45770995-45771017 ATTTTGCATTGGAGGGAAGAAGG - Intronic
949833548 3:8243665-8243687 ATCTGAATTTGGGGGGAGGAGGG - Intergenic
950310147 3:11950032-11950054 GTCGGATTTGGGAGGGAAGAGGG + Intergenic
950385335 3:12654495-12654517 AGCAGGTTCAGGAGGGAAGATGG + Intronic
951403741 3:22268481-22268503 ATCTGGCTTTGCAGGTCAGAGGG + Intronic
951954902 3:28242970-28242992 ATTTGGTTCTTGAGGGTAGAAGG + Intronic
952404712 3:32995038-32995060 CTCTGGCTTTGGAGGGAGGTAGG + Intergenic
953066242 3:39473535-39473557 ATCTGGTCCTGGAGGGATAAGGG + Intronic
953946804 3:47156165-47156187 GTCAGGTTTTGGATGGAAGCAGG - Intronic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
956518746 3:70080589-70080611 ATAGGGTTTTGGAGGGAGGAGGG - Intergenic
957058405 3:75461926-75461948 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
957117977 3:76050755-76050777 ATCAGCTGTAGGAGGGAAGAAGG - Intronic
959383285 3:105669189-105669211 ATATGGATTTGCAGGGAAAAGGG - Intronic
959459841 3:106612173-106612195 TTATTGTTTTGGAGGAAAGAAGG - Intergenic
960025895 3:113008940-113008962 ATCTGGTGGTGTAGCGAAGAGGG - Intronic
961295041 3:125877776-125877798 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
962504130 3:136028775-136028797 ATCTGCATTTGGAGGTAATATGG + Intronic
963511347 3:146251911-146251933 ATTTGATCTTGGAGGGAAGGCGG + Intergenic
963849196 3:150192920-150192942 TTGTTGTTTTGAAGGGAAGAGGG + Intergenic
964205881 3:154174506-154174528 AGCAGGGGTTGGAGGGAAGAAGG + Intronic
964309945 3:155381875-155381897 GTTTAGTTTTGTAGGGAAGAGGG - Intronic
965122617 3:164581627-164581649 TTTTGATTTTGGGGGGAAGATGG - Intergenic
965617422 3:170609277-170609299 TTCTTTTTTTGGAGGAAAGAGGG + Intronic
966276922 3:178184187-178184209 TTCAGGATTAGGAGGGAAGAGGG - Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
966758599 3:183394408-183394430 GTCTGGTTGTGGAGGTAGGAGGG - Intronic
966943939 3:184764439-184764461 ATTTGCTTTTTGGGGGAAGAAGG + Intergenic
967000032 3:185325568-185325590 ATTTGGTTTTGGGAGGTAGAGGG + Intronic
967480686 3:189969608-189969630 ATCTGGGCTTTGAAGGAAGAGGG - Intronic
967806521 3:193719069-193719091 ATCAGGGGTTGGAGGGAAGGAGG + Intergenic
967844747 3:194034773-194034795 GACTGGATTTGGAGGGAAGTAGG + Intergenic
968910307 4:3474009-3474031 ATCCTGTTTTGGGGGGAAGCTGG - Intronic
969149100 4:5153204-5153226 ATTTGGTTTTGGATGCAACAGGG + Intronic
969499995 4:7546824-7546846 ATGTGTTTTTGCAGGGAAGAGGG - Intronic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970942248 4:21648213-21648235 ACCTCGTTTTGCAGGGATGAAGG - Intronic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971272640 4:25164938-25164960 ACCTGGCTTTTGAGGGGAGAGGG - Intronic
971834046 4:31738348-31738370 ATCTGTTTTTGAAGGAAAGGCGG + Intergenic
971927833 4:33037315-33037337 ACCAGGTTTTAGAGGCAAGAGGG + Intergenic
972605973 4:40614247-40614269 ATTTGATGTTGAAGGGAAGATGG - Intronic
973801920 4:54486942-54486964 ATATGAATTTGGAGGGAAGTGGG - Intergenic
974390875 4:61265887-61265909 ATGTGGTTTTGCAAGGAACAGGG - Intronic
975263252 4:72330438-72330460 AACAGGTTTTAGAGAGAAGATGG - Intronic
975358824 4:73441819-73441841 ATCTGGTTTAGGAAGTAACATGG - Intronic
979210869 4:118100393-118100415 ATGTGGTTGTGGAGGCAAGCTGG - Intronic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
981061800 4:140432569-140432591 ATCAGATTTTGGAGGGGACAGGG + Intergenic
981141537 4:141275209-141275231 ATTTGGTTGTGGAGAGTAGAAGG - Intergenic
981196479 4:141926746-141926768 ATCTGCTTTTGCATGGAATATGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
982778326 4:159465192-159465214 ATCTGCTGTGGGATGGAAGATGG + Intergenic
983641199 4:169945376-169945398 ATCTGGTTTAGGGGTGAAGGTGG + Intergenic
984579207 4:181490929-181490951 CGCTTGTTTTGGAGGGTAGAGGG - Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986100828 5:4609609-4609631 ATCTACTTTAGGAGGGAAGGTGG + Intergenic
986240584 5:5956261-5956283 ACAGGGTTTGGGAGGGAAGATGG + Intergenic
986631928 5:9782390-9782412 ATCAGGTTTTGAAGGGGAAAAGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987836313 5:23168067-23168089 ATCTGCTTTGGATGGGAAGAAGG + Intergenic
988131863 5:27116792-27116814 ATGTTATTTTGGAGGGAATAGGG - Intronic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989158128 5:38364328-38364350 ACCTAGTTTTGAAGGAAAGAAGG + Intronic
990014786 5:51046626-51046648 AACTTGTTTTTGAGGGAAGATGG - Intergenic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
990968356 5:61474989-61475011 ATGTGCTTTTGGAGGGCTGAAGG - Intronic
993658137 5:90597601-90597623 ATCTGATATTGAAGGGAAGGAGG + Intronic
995239140 5:109865944-109865966 ATGAGGTTTTGGAGGAAAGCTGG - Intronic
995762296 5:115576313-115576335 ATTTGATTATGGAGGGCAGAGGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996500347 5:124209632-124209654 CTTTGCTTTTGGAGGAAAGAGGG - Intergenic
996579041 5:125009518-125009540 ATTTGGTTGTGAATGGAAGATGG + Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998360021 5:141577235-141577257 TTCTGTTTTTGGAGGGGAGTAGG - Intronic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000278226 5:159758600-159758622 AACTGGTTATGGAGGGAACCGGG - Intergenic
1000633052 5:163612873-163612895 AGCTGGTTCTGGAGAAAAGATGG + Intergenic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1001275466 5:170347723-170347745 ATCTGGTCTGGGAAGGGAGACGG - Intergenic
1001778900 5:174350763-174350785 AGCAGGCTTTGGAGAGAAGATGG - Intergenic
1002071650 5:176682000-176682022 TTCTGGCCTTTGAGGGAAGAAGG - Intergenic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002409591 5:179062999-179063021 AGCTGGTGTTGAAGGAAAGATGG - Intronic
1002876612 6:1216107-1216129 CTTGGGTTTGGGAGGGAAGAGGG - Intergenic
1004094705 6:12541376-12541398 ATCTGTCTTTGAAGGTAAGAAGG - Intergenic
1005292854 6:24396259-24396281 ATCTGGCCTTAGAGGCAAGAAGG - Intergenic
1005445678 6:25920061-25920083 ACTTGGTTTTGGTGGGAAGAAGG + Intronic
1005499886 6:26420687-26420709 ATTTTTTTTTGGAGGGAAGAGGG + Intergenic
1005980725 6:30834555-30834577 TTCTTCTTTTGGGGGGAAGAGGG - Intergenic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006574890 6:35037846-35037868 TCCTGGTTCTGGAGGGAACATGG + Intronic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1012240047 6:96860908-96860930 ATGAGGTTTTGGAGGGGACAGGG + Intergenic
1013136585 6:107288553-107288575 ATTTAGATTTGGAGGGAAGTAGG + Intronic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1014098342 6:117483121-117483143 CTCTGGTTTTGGGGGAAGGAAGG - Intronic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015142491 6:129950826-129950848 ATTTGGTTTTGCAGCCAAGAAGG + Intergenic
1015700829 6:136034574-136034596 ATCTGGTTTTGGCTGGACAAAGG - Intronic
1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG + Exonic
1018571653 6:165217524-165217546 ATCTGGTTTTCAAAGGAAGAGGG - Intergenic
1018605308 6:165591477-165591499 CTTGGGTTTTGAAGGGAAGATGG - Intronic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1020675362 7:11177800-11177822 TTCTGGGTTTTGAGGGGAGAAGG - Intergenic
1026305088 7:69133755-69133777 TTCTGGTTTTGGGGAGAAGATGG - Intergenic
1026533039 7:71216463-71216485 CTTTGCTTTTGGAGGGGAGAGGG + Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1031144253 7:117980183-117980205 ATTTGGTTTTCAAGGGATGAAGG + Intergenic
1032680532 7:134178238-134178260 GCCTGGTTTGGGAGGGAAAATGG - Intronic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1034465439 7:151225772-151225794 GTAAGTTTTTGGAGGGAAGACGG + Intronic
1035255487 7:157623249-157623271 ATCTGGTGTGTGAGGGAAGCTGG + Intronic
1035561431 8:607106-607128 TTCTGGTTTTCAAGTGAAGACGG + Intergenic
1036374966 8:8192138-8192160 AACTGGGTTAGGAGGGAAGCTGG - Intergenic
1036854577 8:12231013-12231035 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1036875936 8:12473506-12473528 AACTGGGTTAGGAGGGAAGCTGG + Intergenic
1038875984 8:31550029-31550051 ATTTGGTTTTAAAGGGAAAATGG - Intergenic
1039011003 8:33092729-33092751 AACTTTTGTTGGAGGGAAGAAGG + Intergenic
1039309786 8:36304379-36304401 ATCAGCTTTTAGAGGGATGACGG + Intergenic
1039572930 8:38601614-38601636 GTCTGGCTTTGGAGTGACGAGGG + Intergenic
1040737755 8:50531502-50531524 ATCTGGATCGGGAGGGAAGAAGG - Intronic
1040792085 8:51243265-51243287 ATCTGGACTTTGAGGGTAGAAGG + Intergenic
1041368004 8:57129830-57129852 ATCTGTTTGTGAAAGGAAGATGG + Intergenic
1042428031 8:68672156-68672178 GTCTGGTTATGGAGGCAAGGGGG + Intronic
1042528028 8:69785212-69785234 AAGTGGTTTTGGAGGCAAAAAGG + Intronic
1043285258 8:78519921-78519943 ATCTGGTTGGGGAAGGAAGATGG - Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1043613983 8:82102983-82103005 TTCTGTTTTTGGAAGGAAAATGG + Intergenic
1044206099 8:89493497-89493519 ATCTGGTTTTCTGGGGAAGTTGG - Intergenic
1045336767 8:101211718-101211740 AACTGATTTAGGAGAGAAGAGGG + Intergenic
1046601426 8:116321405-116321427 GTCTTGCTTTGGAGGGAGGAAGG + Intergenic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1047864541 8:129007586-129007608 ATCTGATAGTGGAGGGTAGAAGG - Intergenic
1048083297 8:131151515-131151537 AGCTGGTTTTGCAGGGCAAAGGG + Intergenic
1048180890 8:132193301-132193323 ACCTGGGCTTGGATGGAAGATGG - Intronic
1048887868 8:138923101-138923123 ACCTGGTTAAGGAGGGGAGAGGG + Intergenic
1049889965 9:59634-59656 GTCTGGCTTTGGCTGGAAGAAGG + Intergenic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1050073843 9:1843579-1843601 ATATGGTTTTGGGGGGAACATGG - Intergenic
1051878728 9:21818087-21818109 ATCTGGGCTTTGAAGGAAGAGGG + Exonic
1052283113 9:26754997-26755019 AGCTGGTTTTGGCTTGAAGAGGG - Intergenic
1052671169 9:31559445-31559467 ATCTGGTTTTGAAAGGAAAATGG + Intergenic
1052742212 9:32404189-32404211 GACTGCTTTTGGAGGGAAGATGG - Intronic
1053230734 9:36406827-36406849 AGCTGGTTTTGGAGGAAGAAAGG - Intronic
1053396815 9:37782834-37782856 ATTTGGTCTTGGAGGGCAGTGGG + Intronic
1053731444 9:41060909-41060931 GTCTGGCTTTGGCTGGAAGAAGG + Intergenic
1054157209 9:61649324-61649346 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054476984 9:65580329-65580351 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054697067 9:68371186-68371208 GTCTGGGTTTGGCTGGAAGAAGG - Intronic
1055666028 9:78553956-78553978 TTTTGGTTTTGGAGGAAAGGAGG + Intergenic
1056743462 9:89280067-89280089 AGCTGGGGTTGGAGGGTAGATGG - Intergenic
1056924855 9:90825769-90825791 ATGTGGTTTTGGAGACAAGTAGG + Intronic
1058474815 9:105322194-105322216 TTCTGGTTTTGAAGGCAGGAAGG + Intronic
1058629387 9:106970874-106970896 ATCTGATCTAGGAGGGAGGAGGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059316835 9:113432982-113433004 AACTTGTTTTGGGGAGAAGAGGG + Intergenic
1060983729 9:127808217-127808239 ACCTTGCTGTGGAGGGAAGAAGG - Exonic
1061206247 9:129165249-129165271 AACTGGATTTGGGGGGCAGAAGG + Intergenic
1061296874 9:129681686-129681708 TTCTGGTTTTGGGGGGTGGAGGG - Intronic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1062134146 9:134915832-134915854 ATGTGGATTTGCAGGGAACATGG - Intronic
1203523596 Un_GL000213v1:67179-67201 TTCTGGTTTTGGAGGGGCCAAGG - Intergenic
1186285504 X:8039647-8039669 ATCTGACATTGGAGAGAAGATGG - Intergenic
1187181232 X:16945980-16946002 AACTGGTTTTGGAGGAATGAAGG + Intergenic
1188594717 X:31885273-31885295 GTATGTTTTGGGAGGGAAGAGGG - Intronic
1188799605 X:34512140-34512162 ATCTCGTCTAGGTGGGAAGAAGG - Intergenic
1193797677 X:85896475-85896497 AGCAGTTTGTGGAGGGAAGATGG + Intronic
1194006757 X:88504260-88504282 CTCTGCTTTAGGAGAGAAGAGGG + Intergenic
1194826918 X:98575964-98575986 ATGTGGACTTGGAGGGAAGGGGG + Intergenic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1195290584 X:103429023-103429045 AACTGGTTCTTGAGGGTAGAGGG - Intergenic
1197698709 X:129579529-129579551 TTCTGCATTTGGTGGGAAGATGG - Intronic
1201614629 Y:15883535-15883557 GGCTGATTTTGGAGGGAAGTTGG + Intergenic
1201615739 Y:15896242-15896264 GGCTGATTTTGGAGGGAAGTTGG - Intergenic
1201906324 Y:19089262-19089284 ATATGGTTTCAGAGGGAAGGTGG - Intergenic