ID: 1043424531

View in Genome Browser
Species Human (GRCh38)
Location 8:80135427-80135449
Sequence CTCTAACTCTCCTGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043424531_1043424539 19 Left 1043424531 8:80135427-80135449 CCTGCCCCCCAGGAGAGTTAGAG 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1043424539 8:80135469-80135491 TGAATATACCCTTACTCTTAAGG No data
1043424531_1043424540 25 Left 1043424531 8:80135427-80135449 CCTGCCCCCCAGGAGAGTTAGAG 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1043424540 8:80135475-80135497 TACCCTTACTCTTAAGGCACTGG No data
1043424531_1043424537 -9 Left 1043424531 8:80135427-80135449 CCTGCCCCCCAGGAGAGTTAGAG 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1043424537 8:80135441-80135463 GAGTTAGAGCTCTGACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043424531 Original CRISPR CTCTAACTCTCCTGGGGGGC AGG (reversed) Intronic
901455721 1:9361749-9361771 CCCTCTCTCTCCTGGAGGGCAGG + Intronic
901957293 1:12795808-12795830 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901960797 1:12825111-12825133 CCATAACTTTCCTGCGGGGCAGG + Exonic
901965312 1:12861591-12861613 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901967394 1:12879713-12879735 CCATAACTCTCCCGGGGGGCAGG + Exonic
901973692 1:12928065-12928087 TTCAAACTCTCCTCAGGGGCAGG - Intronic
901975190 1:12938844-12938866 TCATAACTCTCCCGGGGGGCAGG + Exonic
901980705 1:13031942-13031964 TTCAAACTCTCCTCAGGGGCAGG - Exonic
901982792 1:13049977-13049999 CCATAACTCTCCCGCGGGGCAGG + Intronic
901986230 1:13077361-13077383 CCATAACTCTCCCGTGGGGCAGG - Exonic
901988729 1:13095340-13095362 TTCAAACTCTCCTCGGGGGCAGG + Intergenic
901993084 1:13131427-13131449 TTCAAACTCTCCTCGGGGGCAGG - Intergenic
901995582 1:13149406-13149428 CCATAACTCTCCCGTGGGGCAGG + Intergenic
901999297 1:13178941-13178963 CCATAACTCTCCCGCGGGGCAGG - Intergenic
902001384 1:13196989-13197011 TTCAAACTCTCCTCAGGGGCAGG + Exonic
902009985 1:13262920-13262942 TCATAACTCTCCCGGGGGGCAGG - Exonic
902011486 1:13273702-13273724 TTCAAACTCTCCTCAGGGGCAGG + Intergenic
902017778 1:13322073-13322095 CCATAACTCTCTCGGGGGGCAGG - Exonic
902020620 1:13342694-13342716 TTCAAACTCTCCTCAGGGGCAGG + Exonic
902245940 1:15120413-15120435 CTCTACCCTTCCTTGGGGGCCGG - Intergenic
902374243 1:16022841-16022863 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
902379194 1:16044718-16044740 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
905165765 1:36082295-36082317 CACTGCCTCTCATGGGGGGCTGG - Intergenic
906113374 1:43339127-43339149 CTGTCATTCTCCTGGAGGGCAGG - Intronic
906919766 1:50050580-50050602 CTCTAACTTTCCTGTGGCTCAGG - Intronic
907385237 1:54121672-54121694 CTCTTTCTCTCCAGGGTGGCCGG + Intergenic
907472806 1:54685394-54685416 CTCTAACACTCCTGTGGGGCTGG + Intronic
908595796 1:65687678-65687700 CTCTAAATCTCCAAGGGGTCAGG + Intergenic
912567825 1:110601104-110601126 CTCTACTTCTTCTGGGGGGTGGG + Intronic
917533962 1:175861268-175861290 CTCTACCTCCCCTGAGGGACAGG - Intergenic
918107240 1:181425538-181425560 GTCTAACTCTGCTTGGGGTCGGG - Intronic
920724007 1:208416565-208416587 ATCTATCTGTCCTGGTGGGCAGG + Intergenic
921369156 1:214403845-214403867 CTCTAGCTTTCCTGGGCAGCAGG + Intronic
922764396 1:228149808-228149830 CCCTGATTGTCCTGGGGGGCAGG - Intergenic
922888125 1:229036251-229036273 CTCTGATTCCCCTGGGGGACTGG + Intergenic
924633422 1:245763298-245763320 CTCACACTCTCCTGGGGGCAGGG + Intronic
1064176867 10:13082565-13082587 CTCTAACTCCCCTGGGGAAAGGG + Intronic
1067085943 10:43238162-43238184 GGCTAACCCTCCTGAGGGGCAGG - Intronic
1072348183 10:94529649-94529671 CTCTAATGCTCTTGGGGGACGGG - Intronic
1073286574 10:102393391-102393413 CTCTGACTCTCCTGAGTAGCTGG - Intergenic
1074708486 10:116157490-116157512 CTCTATCCCTTCTGAGGGGCTGG - Intronic
1075241893 10:120786667-120786689 CTCAAACTCACCTGGGGTGAGGG + Intergenic
1075438886 10:122463809-122463831 CTGTAAATTTCCTGGTGGGCTGG + Intronic
1076694537 10:132240761-132240783 CTCTAACCCCCCTGGCTGGCTGG - Intronic
1076709095 10:132321310-132321332 CTCTTACTCTGCAGGTGGGCTGG - Intronic
1076988798 11:258193-258215 CCCTAACGCACCTGGGAGGCGGG + Intergenic
1077317173 11:1924814-1924836 CTCCCACCCTCCTGGGGGCCTGG - Intronic
1077338997 11:2017709-2017731 CTCTAACACTGCTGGAGGGCGGG - Intergenic
1078364233 11:10693410-10693432 CTTTAACTTTCCAGGGGAGCTGG - Intronic
1079110468 11:17602399-17602421 CTCCAGCTCTTCTGGGAGGCAGG + Intronic
1081695931 11:45109103-45109125 CTCAACCTTTCCTGAGGGGCGGG - Intronic
1081858019 11:46316206-46316228 CTGGAGCTCTCCTAGGGGGCTGG - Intronic
1083200564 11:61118756-61118778 CTCTAAGCCTCCTGCGAGGCGGG - Intronic
1083291002 11:61690078-61690100 CGCAAACTCTCCTGGGCTGCAGG + Intronic
1083704383 11:64503971-64503993 CTCTAGCTCTCCTGGGTCTCTGG - Intergenic
1083776234 11:64895497-64895519 CTCAGACTGTCCTGGGGGCCTGG - Intronic
1084447789 11:69213808-69213830 CTCTCACACTCCTGGAGGCCAGG - Intergenic
1085644848 11:78216345-78216367 GTCCACCTCTCCTGGGGGCCTGG - Exonic
1090779982 11:129999288-129999310 CTCAAATTCTCCTGGGGGATAGG - Intronic
1202821981 11_KI270721v1_random:72891-72913 CTCTAACACTGCTGGAGGGCGGG - Intergenic
1091871472 12:3894772-3894794 CTCTTATTATCCTGGGAGGCAGG - Intergenic
1091995787 12:4992826-4992848 CTCTTGCTCTCCTGTGTGGCTGG - Intergenic
1093948378 12:25135849-25135871 CTCTGACTCTCCTTGGGCGGGGG - Intronic
1096570669 12:52521287-52521309 CTGGAACACACCTGGGGGGCTGG - Intergenic
1096684488 12:53278892-53278914 CTCTATCTCGGCGGGGGGGCGGG - Intronic
1099585001 12:84504612-84504634 ATCTAACTCTTATGGGGGGAGGG - Intergenic
1102812047 12:115832840-115832862 CCCCAAGTCTCCTGGGGGCCAGG + Intergenic
1102863365 12:116355320-116355342 CTCCAACTCTCCTGTGCGGTAGG - Intergenic
1104043689 12:125146551-125146573 CTTCATCTCTCCTGGGCGGCAGG - Intergenic
1106093324 13:26619373-26619395 CTGTAAGTCTCCTTGGAGGCTGG + Intronic
1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG + Intronic
1107999283 13:45891586-45891608 ATCTAAATCTTCTGTGGGGCAGG + Intergenic
1109556767 13:63986535-63986557 CTCTACCTCTTCTGGCAGGCAGG + Intergenic
1112545119 13:100360416-100360438 CTCTAACTTTCCTGTGTGGTAGG - Intronic
1115532173 14:34337549-34337571 TTCCAAATCTCCTGAGGGGCTGG - Intronic
1115857690 14:37649002-37649024 CTCTATATATCCTGGGGGGTGGG - Intronic
1117657618 14:57972737-57972759 CTCTCACTCTCCTGCCTGGCTGG - Intronic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1121300058 14:92862920-92862942 CTCTGACTGTCCTGGGGGCCTGG + Intergenic
1122863824 14:104594628-104594650 CACCAAGTCTCCTAGGGGGCGGG + Intronic
1122977305 14:105176121-105176143 CTCCAGCTCTCCTGGGGAACAGG - Intronic
1123585654 15:21758850-21758872 TTCTAACACTACTGGGGGGAAGG + Intergenic
1123622296 15:22201438-22201460 TTCTAACACTACTGGGGGGAAGG + Intergenic
1123964313 15:25439359-25439381 CTGCAACCCTCCTGGGGGGGGGG - Intergenic
1125681054 15:41530379-41530401 CTATACTGCTCCTGGGGGGCAGG + Intronic
1126254187 15:46605574-46605596 CTCTCACTCTCTTTGGGGACAGG + Intergenic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1134027854 16:10968072-10968094 CTTTAGCTGTCCTGGGGGCCGGG + Intronic
1134436173 16:14259632-14259654 CTCTCAGCCTCCTGGGTGGCTGG - Intronic
1136334915 16:29605093-29605115 CTCCCACGCTCCTGGAGGGCAGG + Intergenic
1138301879 16:55937317-55937339 CATGAACTCTCCTGGAGGGCAGG + Intronic
1141700370 16:85639480-85639502 CTCTAAGCCTCCTGGGCGCCAGG + Intronic
1143901402 17:10177306-10177328 CTTTCCCTCTCCTGGGGAGCGGG - Intronic
1146146833 17:30426315-30426337 CTCCAATTCTCCTGCGTGGCTGG - Intronic
1146626482 17:34439111-34439133 CTCTAATTCTGCTGGTGGCCAGG + Intergenic
1146654751 17:34628698-34628720 CTCGGGCTCACCTGGGGGGCAGG - Exonic
1149268758 17:54954626-54954648 CTCTAACTCTACTCGGGGACTGG - Intronic
1150671092 17:67198340-67198362 CTCTAGGTCTCCTGGGGATCTGG + Intronic
1151330136 17:73401773-73401795 CTCTAACTGGCCTTGGGGGGTGG - Intronic
1152112857 17:78366637-78366659 CCCTGACTCTCCTGGGGCTCTGG + Intergenic
1152145854 17:78568333-78568355 TTCTACACCTCCTGGGGGGCAGG - Intronic
1153949401 18:10045517-10045539 CACTGACTCTCCAGGGGGGCAGG + Intergenic
1157569682 18:48704139-48704161 CTCTGATGCTCCTGGGGGGTTGG + Intronic
1159793824 18:72817360-72817382 CTCTCACTCCCATGGTGGGCTGG - Intronic
1161344115 19:3759554-3759576 CACTCACCCTCCTGGGGGGCAGG + Exonic
1161604236 19:5205781-5205803 CTCTCTGTCTCCTTGGGGGCGGG + Exonic
1163465550 19:17466333-17466355 CTCTAACTCCCCTGGGGAAAGGG + Intergenic
1163654116 19:18535762-18535784 CTGTAACTTTCCAGGGGGGAGGG + Intronic
1166907118 19:46119102-46119124 CTCAAACTCACCTGGAGGGCGGG - Intergenic
1167765687 19:51480705-51480727 ATCTAGCTCTCCTTGGGGGTTGG - Intronic
1168125020 19:54278188-54278210 CCAGAGCTCTCCTGGGGGGCAGG + Intronic
1168172245 19:54596541-54596563 CCAGAGCTCTCCTGGGGGGCAGG - Intronic
925114858 2:1369961-1369983 CACCACCTCTCCTGGGGTGCAGG + Intergenic
926561128 2:14418746-14418768 TTCTAATTCTCCTGGGTGTCTGG - Intergenic
926782457 2:16486218-16486240 CTCTAATTCTTCTGAGGGGCTGG - Intergenic
927327107 2:21817780-21817802 GTCAAAATCTCCTGGAGGGCTGG - Intergenic
927419689 2:22917259-22917281 CTCTACCTCTCATGGGAGTCTGG - Intergenic
928883845 2:36126652-36126674 CTCTAGGTCTCCTCTGGGGCTGG + Intergenic
933368696 2:81388228-81388250 CTCTACCTTTCCTGGGGACCGGG - Intergenic
940140298 2:150485750-150485772 CCCTAACTCAGCCGGGGGGCCGG + Intronic
942811378 2:180004696-180004718 AGTTAACTCTCCTGGGGGGGAGG - Intronic
946041633 2:216787869-216787891 CTCTAACACTCCTGGAAGACAGG - Intergenic
946372570 2:219289902-219289924 CTGTAGCTCTCCTGGGGTTCTGG - Exonic
947226679 2:227847421-227847443 CTCACACTCACCTGGAGGGCCGG - Intergenic
948152192 2:235753086-235753108 CTCTTATTCCCCTGGGGGTCAGG + Intronic
1168965393 20:1895240-1895262 CTCCATTTCTCCTGGGGGGCGGG + Intronic
1168981439 20:2007320-2007342 CCCTAACTCTTCTGAGGGGGTGG + Intergenic
1171143951 20:22765760-22765782 CTCTGACTTTCTTGGGGTGCTGG + Intergenic
1172201998 20:33133154-33133176 CTGTATGTCTCTTGGGGGGCGGG - Intergenic
1173190171 20:40869963-40869985 CTGTCACTCTCCTGTGGTGCGGG + Intergenic
1175190675 20:57210509-57210531 GTCTTACTCCCCTGGGAGGCGGG - Intronic
1181082126 22:20422972-20422994 CTGGAACCCTCCTGGGGGGAAGG + Intergenic
1181113504 22:20616329-20616351 CTCCAGATCTCCTGGGAGGCGGG + Intergenic
1182693010 22:32176541-32176563 CTAGAAGTCTCCTGGGGGGTGGG + Intergenic
1183085257 22:35483181-35483203 CTCCCACTCTCCTGTGGGGTAGG + Intergenic
1184337486 22:43862335-43862357 CTCGAACTCCCCCGGGGTGCTGG + Exonic
949634087 3:5963422-5963444 CTCTAAATCTCCTGTAGGGAGGG - Intergenic
950014208 3:9744526-9744548 TGCTCACTCTCTTGGGGGGCTGG - Intronic
953848758 3:46449452-46449474 CTCCTTCTCTACTGGGGGGCTGG - Intronic
955154420 3:56402544-56402566 CACTAGCCCTCCTAGGGGGCAGG - Intronic
963360938 3:144271265-144271287 TTCTAATTCCTCTGGGGGGCGGG - Intergenic
969848690 4:9939764-9939786 CTCCCTCACTCCTGGGGGGCAGG + Intronic
972742341 4:41899419-41899441 CTCTAAATCTCCTGGATGGTGGG - Intergenic
975555760 4:75663380-75663402 CGCTAAATCTCCTGAGTGGCTGG + Intronic
976391451 4:84508930-84508952 ATCTAACTCTCCCATGGGGCTGG - Intergenic
985035722 4:185838331-185838353 CTCTAGCTCCCCTGGGGGCTTGG + Intronic
986495871 5:8340817-8340839 CTCCAACCCTGATGGGGGGCTGG - Intergenic
991707464 5:69371442-69371464 CTATAATTCACCTGGGGGGGGGG - Exonic
992450058 5:76868149-76868171 CTGAAAGTCTCCTGGAGGGCAGG + Intronic
996813865 5:127551895-127551917 CTCACACTGTCCTGGGTGGCAGG - Intronic
997724297 5:136107199-136107221 CTCTATCACTCCTGTGGGGTGGG + Intergenic
1001308230 5:170591271-170591293 CTCAAACTCTACTGGGAGGAAGG - Intronic
1002194678 5:177495464-177495486 CTCTGACTGGCCTGGGGGTCAGG - Intronic
1002721015 5:181261511-181261533 CTCTAACCTTCCTGGGGCTCCGG - Intergenic
1003399602 6:5781089-5781111 CTCCACCTCTCCTCTGGGGCAGG + Intergenic
1004272966 6:14211415-14211437 ATCGCACTCTCCTGGCGGGCTGG + Intergenic
1007626331 6:43248255-43248277 CTCTAACACTCCAGGGGTGGGGG - Intronic
1015726128 6:136301387-136301409 CTCTCACATTCCTGGGGGTCAGG - Intergenic
1019448990 7:1086730-1086752 CACCAGCTCTCCTGGGGGGGAGG + Intronic
1019804729 7:3115185-3115207 GTCTAATTTTCCTGGTGGGCAGG - Intergenic
1020139753 7:5605886-5605908 GCCCAGCTCTCCTGGGGGGCTGG - Exonic
1020342826 7:7131152-7131174 CTCTTGCTCTGCTGGGGTGCTGG + Intergenic
1027225970 7:76243886-76243908 CTCTGCCTCTGCTGGGGGGGTGG + Intronic
1029705256 7:102272677-102272699 CTCTCACCCTCCTGCAGGGCAGG + Intronic
1029711693 7:102303460-102303482 CTCTCAGTCTGCTGGGGTGCAGG + Intronic
1032751378 7:134845396-134845418 TTCTACCTGTCTTGGGGGGCAGG - Intronic
1033123142 7:138684044-138684066 CTCTATCTCGGCAGGGGGGCAGG + Intronic
1036637203 8:10559545-10559567 CTCTAATTCTGCTGGGAAGCTGG - Intergenic
1037917920 8:22783954-22783976 CTCTTCCCCTCCTGGTGGGCAGG - Intronic
1038711349 8:29949880-29949902 CTCTGAATCTCCTGGGAAGCAGG - Intergenic
1040009938 8:42652993-42653015 CTTTATCTCTCCTGGGGGTGAGG + Intergenic
1040536509 8:48315652-48315674 CTCTCAGTCTCCTGAGTGGCTGG + Intergenic
1040997714 8:53418718-53418740 CTCTCAGTCTCCTGAGGAGCTGG + Intergenic
1043424531 8:80135427-80135449 CTCTAACTCTCCTGGGGGGCAGG - Intronic
1044159801 8:88899102-88899124 CTCTAACTCCCCTGGGGAAAGGG - Intergenic
1045332097 8:101164120-101164142 CTGTGACTCTCTTGGGTGGCTGG - Intergenic
1051096894 9:13476923-13476945 CTCTATCTCTGGTGGGGGGCTGG + Intergenic
1062383750 9:136300013-136300035 CTCTGCCTCTCCAGTGGGGCAGG - Intronic
1185582814 X:1224155-1224177 CTCCAGCTCTCCTGGGGGTTTGG + Intergenic
1185622859 X:1464235-1464257 CTCTGACTCTCCAGGGGTGCTGG - Exonic
1186393369 X:9183085-9183107 CTCAAAGTCTCCTGGGTGCCAGG + Intergenic
1187319610 X:18227889-18227911 CACTCAGCCTCCTGGGGGGCGGG + Intergenic
1198795572 X:140390768-140390790 CTCTGGCTCTCCTGGAGGGAAGG - Intergenic
1200014565 X:153148300-153148322 CTGTAACTCTGCCGTGGGGCAGG - Intergenic
1200025037 X:153251654-153251676 CTGTAACTCTGCCGTGGGGCAGG + Intergenic