ID: 1043428424

View in Genome Browser
Species Human (GRCh38)
Location 8:80171418-80171440
Sequence GACCGCGGCGAGCAAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428424 Original CRISPR GACCGCGGCGAGCAAGGTGA GGG (reversed) Intronic
902722478 1:18313164-18313186 GACCGCCGGGAGGAAGGTGAGGG + Intronic
904086661 1:27914270-27914292 GAAGGCGGCGAGGAAGGTTAGGG - Intronic
912701377 1:111880921-111880943 GACCGAGGCTAGCAAGTGGAGGG - Intronic
916233374 1:162561762-162561784 GGTCGCGCCGAGAAAGGTGAGGG + Exonic
1062775379 10:141310-141332 TGCCGAGGCGAGCAAGATGAGGG + Intronic
1065814267 10:29470280-29470302 GACCGCTGCGAACAAGATCAAGG - Exonic
1071695261 10:87863437-87863459 GACCGCGCCGGGCGAGGGGAGGG - Exonic
1075522463 10:123151152-123151174 GCTCGCGGCGAGCAAAGTGGAGG - Intergenic
1078343903 11:10526077-10526099 GACCGAGGCCAGTAAGGTGAAGG + Intronic
1080963371 11:37186215-37186237 GACCGGGATGAGGAAGGTGAGGG - Intergenic
1083301117 11:61740041-61740063 GACAGCTGTGAGCAAGGTGGGGG + Intronic
1084209788 11:67615608-67615630 GCCAGGGGCCAGCAAGGTGAGGG - Intergenic
1089442056 11:118525527-118525549 GACGGAGGCGAGCAGGGTGGCGG - Exonic
1090744094 11:129693049-129693071 GACTGCTGGGAGCATGGTGAGGG - Intergenic
1095450378 12:42324848-42324870 GACCTGGGTGAGCAAGGTGCAGG - Intronic
1097037630 12:56134166-56134188 GACTCAGGAGAGCAAGGTGAGGG + Exonic
1103993021 12:124811863-124811885 GAACGGGCTGAGCAAGGTGAGGG - Exonic
1104448756 12:128853323-128853345 GACCGCGGCTACCCTGGTGATGG + Intergenic
1107059012 13:36135504-36135526 GACCGTGGGCAGTAAGGTGATGG - Intergenic
1117156956 14:52951070-52951092 GAGCGCGGGGAGCCAGGCGAGGG - Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121473434 14:94174207-94174229 GGCCGAGGCGGGCAAGGTGGCGG + Intronic
1121954916 14:98204962-98204984 GACCAAGGCAGGCAAGGTGAAGG - Intergenic
1131375169 15:91917153-91917175 GATGGCAGCGTGCAAGGTGAGGG + Intronic
1132213189 15:100041559-100041581 GACTGTGGTTAGCAAGGTGAAGG + Intronic
1132908799 16:2298051-2298073 GACCACGGCCAGCAAGGTTCTGG + Intronic
1133439949 16:5812747-5812769 GACTGGGCCGAGCAAGGTGGTGG - Intergenic
1136382283 16:29901207-29901229 GGCCCCGAAGAGCAAGGTGAGGG - Exonic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1148615522 17:48997508-48997530 GCCCGCGGCGCGCAGGGAGACGG - Exonic
1153621066 18:6978304-6978326 GAGCGCGGTGAGCACGCTGAGGG - Exonic
1154246354 18:12702866-12702888 GACCCTGGCAAGCAAGGCGATGG - Exonic
1158954285 18:62524082-62524104 GAGCGCGGCGAGGACGGCGACGG + Exonic
1159792957 18:72806689-72806711 GACAGTGGGAAGCAAGGTGAAGG - Intronic
1163635107 19:18433917-18433939 GACCGCGGCGGGCCAGGTGGGGG + Intronic
1166213090 19:41319837-41319859 GACAGTGACGAGGAAGGTGAGGG + Exonic
1167557224 19:50203829-50203851 GACGGCGGCGAGGGAGGTGGGGG + Intronic
1168400339 19:56081998-56082020 GACCCTGGGGAGCAAGGTGACGG - Intergenic
1168641384 19:58034050-58034072 GCCCGCGGCGCGCAGGGTGCGGG + Exonic
926592772 2:14757521-14757543 GACCGCCGTGACCACGGTGAGGG - Intergenic
928606175 2:32947042-32947064 GAGCGGGCCGCGCAAGGTGAGGG - Exonic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
975965198 4:79964832-79964854 CAGCGCGGCGCGCGAGGTGAGGG - Intronic
985632670 5:1022102-1022124 GACAGGGGCCAGCAAGGTCAAGG - Intronic
993696385 5:91066815-91066837 GACAGCAGTGAGCAAGGGGATGG + Intronic
997593800 5:135092702-135092724 GACCGGGGTGAGGAAGGAGAGGG - Intronic
1004370659 6:15049452-15049474 TACCTCAGGGAGCAAGGTGAAGG + Intergenic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006843226 6:37044978-37045000 GAGCGCGACGAAGAAGGTGAGGG - Exonic
1013180569 6:107713764-107713786 GACCGGGGCTGGCAAGGGGAAGG + Intronic
1027048565 7:75007300-75007322 GACCGAGGCCAGCAGGGTCAGGG + Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1035070079 7:156138167-156138189 GACCACAGTGAGAAAGGTGAGGG - Intergenic
1043428424 8:80171418-80171440 GACCGCGGCGAGCAAGGTGAGGG - Intronic
1053279467 9:36808449-36808471 GACCACGGAGAACAAGCTGATGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1060596756 9:124853296-124853318 GACCGCGGCGGGCTGGGAGAAGG - Intergenic
1200163319 X:154019967-154019989 GGCCGCGGCGCGCAAGATGGCGG - Exonic