ID: 1043428453

View in Genome Browser
Species Human (GRCh38)
Location 8:80171539-80171561
Sequence TTCGCGGGAGTCGCCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428453_1043428459 0 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428453_1043428468 9 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428453_1043428464 6 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428453_1043428460 1 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428453_1043428471 30 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428453_1043428470 25 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428453_1043428458 -6 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428458 8:80171556-80171578 CGCGAAGTCCCCACCCCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428453 Original CRISPR TTCGCGGGAGTCGCCGGCGG AGG (reversed) Intronic
901074570 1:6545400-6545422 TTCTCTGGAGTCTCCTGCGGAGG - Intronic
905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG + Intronic
909629856 1:77759857-77759879 ATCGCCGGAGACGCCTGCGGCGG - Intergenic
910676395 1:89820953-89820975 GTCGCGGCACTCGCCGGCTGCGG + Intronic
917975473 1:180235034-180235056 TTTGGGGGACTCGCCGGTGGAGG + Intronic
923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG + Intronic
924539928 1:244970825-244970847 TGCGCCGGAGGCGCCGGCAGGGG + Exonic
1067972722 10:50991327-50991349 TTCTCGGGCGGCGGCGGCGGCGG - Intergenic
1080457737 11:32431111-32431133 TTCTCTGCAGCCGCCGGCGGGGG - Intronic
1080551270 11:33375950-33375972 TGCGCGGGAGCCGCCGGGAGGGG + Intergenic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1139513737 16:67441425-67441447 CTAGCTGGAGTCGCCGGCGAGGG - Intronic
1140223242 16:73058661-73058683 CTGGCGGGGGTCGGCGGCGGCGG + Intronic
1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1145815783 17:27793898-27793920 TCCGCGGCAGACGCCGGCTGCGG - Intronic
1148759755 17:49993630-49993652 GTCGCAGGAGTCGCAGGCCGAGG - Intronic
1149597889 17:57874842-57874864 TTCGGGCGGGTGGCCGGCGGCGG + Intronic
1151218254 17:72592392-72592414 CTCGCGGAGGTCGCGGGCGGGGG + Intergenic
1162381235 19:10333181-10333203 TGCGCGGGGGTCGTTGGCGGGGG - Intronic
1163663003 19:18589572-18589594 CTCGCGGGAGGTGCTGGCGGTGG + Exonic
1167220379 19:48195288-48195310 GACGCAGCAGTCGCCGGCGGTGG - Exonic
1167377259 19:49118862-49118884 TGCGTGGGAGTCGCGGGTGGGGG + Exonic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
1176005768 20:62861634-62861656 ACCGCGGGAGCCGCCGCCGGAGG - Exonic
1178466181 21:32850179-32850201 TTCGGGGGAGTCGCAAGAGGGGG + Intergenic
1179529542 21:42009633-42009655 TCCGCGGGAGGGGCCGGGGGCGG + Intronic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
961012937 3:123448189-123448211 GTCGCGGCAGCCGCCGGCAGCGG - Exonic
969674579 4:8607781-8607803 TTTCCGGGAGGCGCCGGCAGAGG + Intronic
971457870 4:26861053-26861075 GCCGGAGGAGTCGCCGGCGGCGG + Exonic
979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG + Exonic
983649791 4:170026504-170026526 TTCGCGGCAGCCGCGGGCGGGGG + Intronic
989584815 5:43066509-43066531 TTCCCGGGCGACGCCGGCGCTGG - Intronic
996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG + Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1003069710 6:2936102-2936124 TGCGCGGGAGCCCACGGCGGCGG - Intergenic
1010703129 6:79077106-79077128 CGCGCGAGAGTCGGCGGCGGCGG - Intronic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1011488421 6:87867025-87867047 TTGGTGGGAGTCCCCGGTGGAGG + Intergenic
1024629977 7:51238860-51238882 TTCCCGGGAGTCCCCGGTGAAGG + Intronic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1047100155 8:121667522-121667544 TGCGCAGGAGCCCCCGGCGGGGG + Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1187332581 X:18354396-18354418 TCCGCGGAAGGCGCCGGGGGCGG + Intronic
1189002875 X:36963969-36963991 GCCGCGGGAGCCGCGGGCGGGGG - Intergenic