ID: 1043428453

View in Genome Browser
Species Human (GRCh38)
Location 8:80171539-80171561
Sequence TTCGCGGGAGTCGCCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428453_1043428464 6 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428453_1043428458 -6 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428458 8:80171556-80171578 CGCGAAGTCCCCACCCCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1043428453_1043428471 30 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428453_1043428460 1 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428453_1043428468 9 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428453_1043428459 0 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428453_1043428470 25 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428453 Original CRISPR TTCGCGGGAGTCGCCGGCGG AGG (reversed) Intronic