ID: 1043428454

View in Genome Browser
Species Human (GRCh38)
Location 8:80171542-80171564
Sequence GACTTCGCGGGAGTCGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428454_1043428471 27 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428454_1043428468 6 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428454_1043428470 22 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428454_1043428460 -2 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428454_1043428459 -3 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428454_1043428464 3 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428454_1043428458 -9 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428458 8:80171556-80171578 CGCGAAGTCCCCACCCCCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428454 Original CRISPR GACTTCGCGGGAGTCGCCGG CGG (reversed) Intronic
911902822 1:103526276-103526298 GCCTTCCCGGGAGACTCCGGAGG - Intronic
923163746 1:231339579-231339601 GCCATCGCGGGAGGCGCCCGCGG + Intronic
1083945163 11:65919362-65919384 GACTCCGCGGGAAACGGCGGGGG + Exonic
1084790801 11:71474295-71474317 GACCTAGCGGGACTCGGCGGAGG + Intronic
1088648558 11:111937596-111937618 GACTGGGCGGGAGACGCTGGGGG - Intronic
1116003433 14:39267557-39267579 GGGGTCGCGGGAGCCGCCGGGGG + Intronic
1119618435 14:76113548-76113570 GACTTCCAGGGAGTAGCCTGAGG + Intergenic
1125516611 15:40324316-40324338 GACTTCGGGGGCGGCGGCGGCGG + Intergenic
1136344006 16:29663647-29663669 GAACACGCGGGAGTTGCCGGAGG - Intronic
1142586661 17:978866-978888 GAATCCGCGGGGGTCGGCGGCGG + Intronic
1144565053 17:16353141-16353163 GGGGTCGCGGGAGTCGGCGGCGG + Exonic
1166796445 19:45428937-45428959 GATGACGCGGGAGCCGCCGGGGG + Intronic
1167220380 19:48195291-48195313 GACGACGCAGCAGTCGCCGGCGG - Exonic
1167377256 19:49118859-49118881 GTCTGCGTGGGAGTCGCGGGTGG + Exonic
948993440 2:241565749-241565771 GCCTTCGTGGGAGTCTCCTGGGG - Intronic
1169478177 20:5950858-5950880 GACTTGGCAGGAGTCGCCTGAGG + Exonic
1172284722 20:33732348-33732370 AACTGCGCGGGAGGCGACGGCGG + Intronic
949227317 3:1710628-1710650 CACTTCGTGGGAGTTGCCAGAGG + Intergenic
950618082 3:14178424-14178446 GGCTTCGCGGGAGACGCCGCCGG - Exonic
955807584 3:62753699-62753721 GACCTCCCGGGAGTCGTTGGCGG + Exonic
970585631 4:17511901-17511923 GTCTCCGCGGGGGTGGCCGGGGG - Intronic
982380524 4:154743664-154743686 CACTTCGCGGTAGTCTTCGGTGG - Intronic
1007264597 6:40587058-40587080 GCATTCGCCGGAGCCGCCGGAGG - Exonic
1022010622 7:26305121-26305143 GACTTCACTGGAGTCCCCTGTGG + Intronic
1022099739 7:27161897-27161919 GACTCCGCGGGGGTGGCGGGCGG + Intergenic
1033369625 7:140696656-140696678 GACGTCACGGGAGGCGCGGGCGG + Exonic
1036210080 8:6834612-6834634 GAGTTCGCGGGCGTCCCCGCAGG - Intronic
1043428454 8:80171542-80171564 GACTTCGCGGGAGTCGCCGGCGG - Intronic
1045674010 8:104588716-104588738 GTCTCCGCGGGAGTCTCCAGGGG + Intronic
1053166336 9:35846418-35846440 GACTTGGCGGGGGTGGCCCGGGG + Intronic
1062306193 9:135908052-135908074 GACCTCGTGGGTGTGGCCGGCGG + Intergenic