ID: 1043428459

View in Genome Browser
Species Human (GRCh38)
Location 8:80171562-80171584
Sequence GTCCCCACCCCCAGAGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 175}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428453_1043428459 0 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428452_1043428459 5 Left 1043428452 8:80171534-80171556 CCTCGCCTCCGCCGGCGACTCCC 0: 1
1: 0
2: 4
3: 39
4: 342
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428447_1043428459 28 Left 1043428447 8:80171511-80171533 CCGCCGCGCCGCGCAGAGCTCCT 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428454_1043428459 -3 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428451_1043428459 8 Left 1043428451 8:80171531-80171553 CCTCCTCGCCTCCGCCGGCGACT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428449_1043428459 20 Left 1043428449 8:80171519-80171541 CCGCGCAGAGCTCCTCCTCGCCT 0: 1
1: 0
2: 0
3: 23
4: 406
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428455_1043428459 -6 Left 1043428455 8:80171545-80171567 CCGGCGACTCCCGCGAAGTCCCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428446_1043428459 29 Left 1043428446 8:80171510-80171532 CCCGCCGCGCCGCGCAGAGCTCC 0: 1
1: 0
2: 3
3: 16
4: 228
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175
1043428448_1043428459 25 Left 1043428448 8:80171514-80171536 CCGCGCCGCGCAGAGCTCCTCCT 0: 1
1: 0
2: 1
3: 4
4: 135
Right 1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG 0: 1
1: 0
2: 0
3: 26
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428459 Original CRISPR GTCCCCACCCCCAGAGGCGT CGG Intronic
900243194 1:1626435-1626457 GTCCCTAGCCCCAGAGCCATGGG - Intronic
900462795 1:2809491-2809513 TTGCCCACCCCCAGAGCCATCGG - Intergenic
900545324 1:3225790-3225812 GGCCCCACCTCCAGAAGTGTCGG + Intronic
901045166 1:6391962-6391984 TTCCCCACCTCCAGAGTCGATGG + Intronic
901829130 1:11881412-11881434 GGCCCCATCCCCTGAGGCCTAGG + Intergenic
903004352 1:20288904-20288926 GTCCCCACCCCCTGTGGAGCGGG + Intergenic
903069304 1:20718616-20718638 GTGCCCACCACCAGAGACGCGGG - Intergenic
912513038 1:110201369-110201391 GTCCCCACCCCCACTGGCTTTGG + Exonic
913695398 1:121319917-121319939 TTCCCCACCCCCAGAGCCTTAGG - Intronic
914142165 1:144960143-144960165 TTCCCCACCCCCAGAGCCTTAGG + Intronic
915603880 1:156938894-156938916 GTCCCCACCCCGGGAAGAGTGGG - Intronic
917599464 1:176559948-176559970 CTCCCCAGCCCCAGATGCGGGGG + Intronic
918487669 1:185045992-185046014 GCCCCCGCCCCCGGAGGCGAGGG - Intronic
919716139 1:200778909-200778931 GGCCCCACGCCAAGAGCCGTAGG - Intronic
919842859 1:201622206-201622228 GTCCCCACCCCCATAGTCACTGG - Intergenic
920482729 1:206338296-206338318 TTCCCCACCCCCAGAGCCTTAGG - Intronic
921947700 1:220897616-220897638 CCCCCCACCCCCAGAGGCCTCGG + Intergenic
923184239 1:231554454-231554476 GTCCCCACCCTCAGAGTTCTAGG + Intronic
923456742 1:234171273-234171295 GTCCCCAGCCCCAGAGGCCCTGG + Intronic
1069693721 10:70371813-70371835 TTCTCCATCCCCAGAGACGTGGG - Intronic
1069754181 10:70763258-70763280 GTTCCCACCCCCACGGGGGTAGG - Intergenic
1069953292 10:72034352-72034374 GTTCCCTCTCCCGGAGGCGTAGG + Intergenic
1070330023 10:75409787-75409809 GCCCCCAACCCCGGAGGCCTCGG + Intergenic
1071650619 10:87390902-87390924 GTCCGCGCCCACACAGGCGTAGG + Intergenic
1073058174 10:100715293-100715315 TTCCCCACCCCAAGTGGCTTAGG + Intergenic
1075794015 10:125106243-125106265 GTCCCCACACCCAGGGTTGTGGG - Intronic
1076110596 10:127856360-127856382 GACTTCACCCCCAGAGGCTTCGG - Intergenic
1076725507 10:132411109-132411131 CTCCTGACCCCCAGAGGCGTGGG - Intronic
1079430905 11:20387704-20387726 GTCCCCGCCCCCAGACACGCCGG + Exonic
1080020458 11:27554280-27554302 GGTCCCACCCCCAGAGTAGTTGG - Intergenic
1084000342 11:66292394-66292416 GCCCCCACCCCCAGGGCCGCGGG + Intronic
1084575629 11:69986289-69986311 GTCCCCGCCACCAGAGGTGGGGG - Intergenic
1084891403 11:72238759-72238781 GCCCCCACCCCCAGCGGGGGTGG - Exonic
1085504892 11:77052746-77052768 GTGTCCACCCCCCGAGGAGTAGG + Intergenic
1087528628 11:99351007-99351029 GCCCCCACCCCCACAGGCCTTGG - Intronic
1088679487 11:112226711-112226733 GTCCCCAGCCCTGGAGGGGTGGG + Intronic
1091271408 11:134314250-134314272 GTACCCACCCCAGGTGGCGTGGG - Intronic
1091787627 12:3252511-3252533 GTCCCCACCCCCGGAGCTCTGGG - Intronic
1094499025 12:31006898-31006920 GGCCCCACCCCCAGAGAAATGGG - Intergenic
1096693439 12:53334836-53334858 GTCCCCAGCACCAGAGGCAAGGG + Intronic
1096717279 12:53499244-53499266 CTTCCCAGCCCCACAGGCGTCGG + Intronic
1098550416 12:71755328-71755350 TTCCCCAGCCCCGGAGGGGTAGG - Intronic
1102119540 12:110429618-110429640 GTCCCCACCACCAACGGAGTGGG + Intergenic
1102430171 12:112876808-112876830 GCCACCACCCCCAGAGGAGGAGG + Exonic
1103484844 12:121275671-121275693 GTCACCACCCCCATAGTCCTAGG - Intronic
1103539147 12:121653993-121654015 GTCACCACCCCCATAGTCCTAGG + Intronic
1103963963 12:124626388-124626410 GGCCCCACCCCCAGGGGCCCAGG + Intergenic
1104231904 12:126893102-126893124 TTCCCCACCCCCACAGGCCCTGG - Intergenic
1104854966 12:131897199-131897221 GCCCTCGCCCCCACAGGCGTGGG + Intronic
1105064123 12:133181883-133181905 GTCCCCAAACCCAGAGGGGGAGG - Intronic
1111292703 13:86188467-86188489 GGCCCCACCCCCACAGACCTAGG + Intergenic
1114613617 14:24057098-24057120 CTCGCCACCCCCAGAGGCCATGG - Intronic
1117630253 14:57683854-57683876 CACCCCAACCCCAGAGGAGTTGG - Intronic
1118242450 14:64073163-64073185 GTCCCCTCCCCCAGAGGTTGGGG + Intronic
1119649861 14:76375948-76375970 GTCCCCACCTCCTGAGCAGTAGG - Intronic
1120867731 14:89310005-89310027 GTCCCCACCCCCGCATGGGTAGG - Intronic
1121311681 14:92938752-92938774 GTCCCCACCCCAAGAGCCAAGGG - Exonic
1122517047 14:102316184-102316206 GTACCCACCCCTAAAAGCGTAGG - Intergenic
1123039471 14:105484515-105484537 GTCCCCACCCCCAGAGCACAGGG + Intergenic
1125070207 15:35545809-35545831 GGCCCCACCGCCAGAGGGATTGG - Intronic
1128240154 15:66096149-66096171 ATCCCCACCCCCACAGGCTGAGG + Intronic
1129869409 15:78931162-78931184 GGCCACACTCCCAGAGGCCTTGG + Intronic
1133063199 16:3188643-3188665 GTCCCCACCCCCAGACCCCGGGG + Intergenic
1135751951 16:25065379-25065401 GTCCCCACCCCCAGAGATACGGG - Intergenic
1136390213 16:29959556-29959578 GTCCCCAACCCCTGGGCCGTGGG - Intronic
1137404974 16:48182337-48182359 GTCCTCACCCTCAGACGCCTGGG + Intronic
1140223016 16:73057953-73057975 TGCCCCACCCCGAGAGGCGCCGG - Intronic
1141171179 16:81692710-81692732 GTCCCCGTCCCCATAGGCCTGGG + Intronic
1142227306 16:88883896-88883918 GACCTCAGCCCCAGAAGCGTGGG - Intronic
1142420566 16:89967043-89967065 GTCCCCTCACCCAGAGCTGTAGG - Exonic
1142695172 17:1629264-1629286 GTCACCACGCCCAGATGCGCCGG + Intergenic
1143608487 17:8003985-8004007 GTCCCCAGGCCCGGAGGCCTTGG + Exonic
1143840230 17:9725942-9725964 TTCCCCACCCCCCGAGGGCTGGG + Intronic
1144208323 17:12994632-12994654 GTCCCCACCCTCAGAGTCTCTGG - Intronic
1144750971 17:17647850-17647872 GGCCCCACCCCCAGAGATGCTGG + Intergenic
1144835965 17:18156892-18156914 CACCCCACTCCCAGAGGCCTAGG - Intronic
1144957975 17:19029046-19029068 GTCCCCTCACCCAGAGGAGTGGG - Intronic
1144977183 17:19145474-19145496 GTCCCCTCACCCAGAGGAGTGGG + Intronic
1146173466 17:30650100-30650122 GGGGCCACCCACAGAGGCGTGGG - Intergenic
1146280219 17:31539884-31539906 CTCCCCTCCCCCAGGAGCGTGGG - Intergenic
1146346923 17:32066130-32066152 GGGGCCACCCACAGAGGCGTGGG - Intergenic
1146677081 17:34781098-34781120 GGCCCCAAGCCCAGAGGCTTAGG - Intergenic
1147381982 17:40061780-40061802 GGCCCCACCCTGAGAGCCGTGGG + Intronic
1148687825 17:49510437-49510459 GTCCACACCCCCAGAGGGCTCGG + Exonic
1150475646 17:65472514-65472536 GTTCCCACACCCAGAGGTCTAGG + Intergenic
1150711124 17:67531756-67531778 CTCCCCCATCCCAGAGGCGTCGG + Intronic
1151352073 17:73537626-73537648 GTCCCCACCCACACAGGCTTCGG - Intronic
1152335178 17:79696633-79696655 GGCCCCACCCCCACAGGCCTAGG + Intergenic
1154445315 18:14431138-14431160 CTCCTCACCCCCAGAGGAGACGG + Intergenic
1156312845 18:35940643-35940665 GTCCTCACCCTCCTAGGCGTTGG - Intergenic
1157535491 18:48454376-48454398 TTCCCCACCCCCAGACGCCATGG + Intergenic
1159947384 18:74454461-74454483 TTCCCCACCCCCAGTAGCGGGGG - Intronic
1160344980 18:78124876-78124898 TTCCCCACCCCCACAGGTGTGGG + Intergenic
1161699934 19:5789023-5789045 GTCCCCACCTCCTGAGGGCTGGG + Intronic
1162450083 19:10749238-10749260 GTCCCCACCCTCATAGGGGCTGG + Intronic
1162944009 19:14031636-14031658 GCCCCCACCCCCAGACGCCCAGG + Intergenic
1163518471 19:17778775-17778797 GGCGCCACCCCCAGAGGCCAGGG + Exonic
1163606919 19:18280791-18280813 GCCGCCACCCCCAGGCGCGTTGG - Exonic
1163617023 19:18335426-18335448 GGCTCCACCCCCAGAGACCTAGG + Intergenic
1165896168 19:39142557-39142579 TTCCCCACCCCCCGGGGCCTGGG + Intronic
1165925889 19:39326195-39326217 GGCCCCACCCCCAGACTCTTAGG + Intergenic
1166317767 19:41998504-41998526 CTCCCCACCTCCAGAAGCGTGGG + Exonic
1166811244 19:45515878-45515900 GTCCCCACCTCCAGGGCAGTGGG - Intronic
1168110991 19:54191240-54191262 GGCCCCGCCCCCTGAGGCCTAGG + Intronic
1168270096 19:55245232-55245254 CCCCCCACCCCCAGAGGAGCCGG + Intronic
926117219 2:10221175-10221197 CCCCCCACCCCCAGAGGAATTGG - Intergenic
926117919 2:10224944-10224966 GCCCCCACCCCCACAGGCTTCGG + Intergenic
927709295 2:25315018-25315040 CTCCCCACCCCCGGAGGAGGCGG + Intronic
929928997 2:46237725-46237747 GTCCCCACCCCCACAGACACAGG - Intergenic
930271774 2:49265698-49265720 GTCCCCTCCCCCATAGGCTCTGG - Intergenic
936034498 2:109100172-109100194 GTCCCCAGCTCCTGAGGCATGGG + Intergenic
936521463 2:113214436-113214458 GTGCCCACCCCCAGAGGACAAGG + Intergenic
938397245 2:130960803-130960825 GTCCTCACCCCCAGGGTCTTAGG + Intronic
941367088 2:164621747-164621769 GTCCCCGCCTCCAGCGGCGCCGG - Exonic
943664253 2:190592108-190592130 GACCCCTCCCCCAGAGGTGCAGG + Intergenic
946302066 2:218830175-218830197 GTTCCCAGCCACAGAGGCCTGGG - Exonic
947763970 2:232624066-232624088 GACCCCACCCCCACAGCCCTGGG - Intronic
1170128144 20:12988504-12988526 GTCCCCACCTCCAGAGGTGATGG - Intergenic
1171095864 20:22331904-22331926 GGCCCCTCCCCCAGAGGCTTTGG + Intergenic
1172244715 20:33438012-33438034 GCCACCACGCCCAGAGGCCTTGG - Intronic
1172609596 20:36240168-36240190 GTCCCCAGCCCCAGAGTCTGAGG + Exonic
1173896983 20:46558747-46558769 ATCTCCACCCTCAGAGGCTTAGG + Exonic
1176023673 20:62975127-62975149 GTCCCCACCCCCAGATTCAAGGG - Intergenic
1176412442 21:6456388-6456410 GTACCAACCCCCACAGGCCTTGG + Intergenic
1178829512 21:36044155-36044177 GTGGCCACCCCCAGAGCCCTAGG - Intronic
1179572012 21:42283836-42283858 GTCCCCCCGCCCAGATGAGTGGG + Intronic
1179572033 21:42283896-42283918 GTCCCCCCGCCCAGATGAGTGGG + Intronic
1179572098 21:42284078-42284100 GTCCCCCCGCCCAGATGAGTGGG + Intronic
1179572141 21:42284199-42284221 GTCCCCCCGCCCAGATGAGTGGG + Intronic
1179687936 21:43064710-43064732 GTACCAACCCCCACAGGCCTTGG + Intronic
1179881823 21:44296239-44296261 GCCCCCACCCCCAGTGGAGCTGG + Intronic
1179884367 21:44307121-44307143 GCCCCCACTCACAGAGGCCTCGG - Intronic
1180246406 21:46550844-46550866 GACCCCAGCCCCAAAGACGTGGG - Intronic
1182281175 22:29218533-29218555 TTCCCCACCTCCTGAGGCCTGGG - Intronic
1182366683 22:29783901-29783923 CTCCCCACCCCCAGGGGAGGGGG + Intergenic
1182810427 22:33111497-33111519 CTTCCCACCCCCAAAGGCATAGG + Intergenic
1183212238 22:36458156-36458178 GGCCCCACCCCCAGGGGCTGTGG - Intergenic
1183371566 22:37435521-37435543 CTCCCCACACCCAGAGGAGAAGG + Intergenic
1183726852 22:39594664-39594686 GACCCCACCCAGAGAGGAGTGGG - Intronic
1184466603 22:44672181-44672203 GTCCCCTGCCCCAGAGGAGTAGG + Intronic
1184857751 22:47155760-47155782 GTGCCCACCCTCAGGGGCGGTGG + Intronic
950540443 3:13609234-13609256 GTCCCCACCCCCACAACGGTCGG - Intronic
953925478 3:46980358-46980380 GCCCACACCCCCAGACCCGTTGG - Intronic
954292377 3:49656419-49656441 GCCCCCAGCCCCAGGGGCCTTGG - Exonic
962676217 3:137760627-137760649 TTCCCCAGCCCCAGAGGCCTTGG + Intergenic
962950689 3:140215957-140215979 GTCCCCAACCCCTGGGGCCTCGG + Intronic
968429296 4:545873-545895 GTCCCCACCCCCAGCAGGGGTGG - Intergenic
968966593 4:3772084-3772106 GCCCCCACCCCCGGAGTCGGGGG - Intergenic
969432853 4:7166077-7166099 TCCCCCGCCCCCAGAGGCCTCGG - Intergenic
969449526 4:7265041-7265063 GGCCCCAACTCCAGAGGCATCGG - Intronic
973540328 4:51928638-51928660 TTTCCCACCCCCAGTGGCATTGG - Intergenic
982411515 4:155082824-155082846 GTCCCCAGCCCCAGAAGCAGAGG - Intergenic
985538092 5:475553-475575 GTCCCCACCTGCAGGGGAGTCGG + Exonic
987930581 5:24395255-24395277 GCCCCCACCTCCAGAGTCATGGG - Intergenic
990812236 5:59741117-59741139 GTCCCCATCCCCAAAGGCTCTGG + Intronic
991306035 5:65177200-65177222 GCCCCCACCTCCAGAGTCGTGGG + Intronic
993972874 5:94441515-94441537 GTCCCCATCTCCAGATACGTTGG - Intronic
994952536 5:106482846-106482868 GACCCCACCCTCAGAGACTTAGG + Intergenic
995868547 5:116719634-116719656 GTCCCCATCCCTAGAGGGATTGG - Intergenic
996347385 5:122501755-122501777 GTCCCCACCACCACAGGCCCCGG - Intergenic
998424164 5:142012907-142012929 GTCCCGACCCCGAGTGCCGTAGG + Intronic
999153719 5:149443077-149443099 GTCCCCGCCACCAGGGGCATGGG + Intergenic
1002066539 5:176654740-176654762 CTCCCCACCCCCACAGGCCTGGG - Intronic
1002188630 5:177467706-177467728 GTCCCCACCCCCAAGAGCGCTGG + Intronic
1002418028 5:179130885-179130907 GACCTCAGCCCCAGAGGCGGTGG + Intronic
1002900165 6:1404445-1404467 GTCCCCATCCCAAGAGGAATGGG + Intergenic
1006474378 6:34245203-34245225 GTCCCCACCACCAAGGGAGTGGG - Exonic
1006828456 6:36954364-36954386 GACCCTACCCACAGAGGAGTGGG - Intronic
1010273091 6:73937205-73937227 GTCCCCAGCCAAAGAGGGGTTGG - Intergenic
1017198146 6:151724058-151724080 GCCCCTGCCCCCACAGGCGTGGG - Intronic
1018844132 6:167543425-167543447 GTCCTCACACCAAGAGGCGATGG + Intergenic
1019493010 7:1323821-1323843 CTCCCCAGTACCAGAGGCGTTGG + Intergenic
1022420894 7:30222627-30222649 ATTCCCACCCCCAGGAGCGTGGG + Intergenic
1023856178 7:44185677-44185699 GTCCTCATCCCCAGAGGCCTGGG + Intronic
1028910841 7:96205809-96205831 GTCCCCACCCACTAAGGTGTTGG - Intronic
1029606520 7:101602526-101602548 TTCCCAAGCCCCAGAGGCTTTGG + Intergenic
1032530429 7:132615392-132615414 GTCCCCTCCGCCAGGGGCGGGGG - Intronic
1033361419 7:140640967-140640989 TCCCCCACCCCGAGAGGCGAGGG - Intronic
1036453323 8:8888393-8888415 GTCCCCACCCCCAGGGGACCCGG - Intronic
1036949996 8:13131981-13132003 GTCCCCACCTCCAGAGTCCTGGG - Intronic
1037450752 8:19013863-19013885 CTCCCCCCTCCCCGAGGCGTCGG - Intronic
1043092492 8:75923843-75923865 GTCCACACCACCAGAGCCTTGGG + Intergenic
1043428459 8:80171562-80171584 GTCCCCACCCCCAGAGGCGTCGG + Intronic
1043639402 8:82432438-82432460 TTCCCCAACCCCAAAGTCGTGGG - Intergenic
1046786515 8:118272388-118272410 GGCCCCAGGCCCAGAGGCATAGG - Intronic
1049583224 8:143421993-143422015 GTCACCTCCCCCAGAGGGGTGGG - Intronic
1050692799 9:8247505-8247527 CCCCCCACCCCCAGAGTCATTGG + Intergenic
1051402022 9:16693335-16693357 CTGCCCACCCCCAGAGGGTTGGG - Intronic
1055422940 9:76162801-76162823 ACCCCTACCCCCAGAGGGGTAGG - Intronic
1056414465 9:86362867-86362889 GCCCCCCCACCCAGAGTCGTGGG - Intergenic
1057177450 9:93010429-93010451 CTCCCCACCCCCAGAGTTCTTGG - Intronic
1057346275 9:94253778-94253800 CTCCCCAACCCCAGAGGAGCTGG + Intergenic
1057596118 9:96417652-96417674 GTCCTCACCTCCCGAGGCGGCGG + Exonic
1059429534 9:114241499-114241521 CTCCCCACCCCCACAGGCTCAGG - Intronic
1061009596 9:127947045-127947067 GCCCCAACCCCCAGAGGAGATGG - Intronic
1061946980 9:133913983-133914005 GTCCCCACTCCAAGAGCCGCTGG + Intronic
1188156489 X:26748674-26748696 GTCCCCACCACCAAAGGAGTGGG - Intergenic
1188671606 X:32888314-32888336 GCCCCCACCCCCACAGGCTCCGG + Intronic
1195704188 X:107726710-107726732 GGCCCCACCCACAGAGACCTGGG - Intronic
1196272576 X:113729865-113729887 CTCCCCACCCCGATAGGCCTTGG + Intergenic
1197819497 X:130530276-130530298 GACCCCACCCCCTCAGCCGTGGG + Intergenic
1200234634 X:154462325-154462347 GTCCCCACCCCCACATGCCCAGG - Intronic