ID: 1043428460

View in Genome Browser
Species Human (GRCh38)
Location 8:80171563-80171585
Sequence TCCCCACCCCCAGAGGCGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 221}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428455_1043428460 -5 Left 1043428455 8:80171545-80171567 CCGGCGACTCCCGCGAAGTCCCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428453_1043428460 1 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428454_1043428460 -2 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428448_1043428460 26 Left 1043428448 8:80171514-80171536 CCGCGCCGCGCAGAGCTCCTCCT 0: 1
1: 0
2: 1
3: 4
4: 135
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428446_1043428460 30 Left 1043428446 8:80171510-80171532 CCCGCCGCGCCGCGCAGAGCTCC 0: 1
1: 0
2: 3
3: 16
4: 228
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428447_1043428460 29 Left 1043428447 8:80171511-80171533 CCGCCGCGCCGCGCAGAGCTCCT 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428449_1043428460 21 Left 1043428449 8:80171519-80171541 CCGCGCAGAGCTCCTCCTCGCCT 0: 1
1: 0
2: 0
3: 23
4: 406
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428451_1043428460 9 Left 1043428451 8:80171531-80171553 CCTCCTCGCCTCCGCCGGCGACT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1043428452_1043428460 6 Left 1043428452 8:80171534-80171556 CCTCGCCTCCGCCGGCGACTCCC 0: 1
1: 0
2: 4
3: 39
4: 342
Right 1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG 0: 1
1: 0
2: 2
3: 32
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428460 Original CRISPR TCCCCACCCCCAGAGGCGTC GGG Intronic
900462794 1:2809490-2809512 TGCCCACCCCCAGAGCCATCGGG - Intergenic
900676261 1:3888480-3888502 TCCCCAGCCCCAGCGGCGTCAGG - Intergenic
900684608 1:3940092-3940114 TCCCCTCCCCAAGAGAAGTCGGG - Intergenic
901045167 1:6391963-6391985 TCCCCACCTCCAGAGTCGATGGG + Intronic
901109610 1:6784850-6784872 TCCCCACCGGCAGCGGCGGCGGG + Intergenic
902222610 1:14976598-14976620 TGCCCAGCCCCAGAGGAGGCCGG + Intronic
902637319 1:17743245-17743267 CCTCCACCCTCAGAGGCATCAGG - Intergenic
903276195 1:22223485-22223507 GCCCCATCCTCAGAGGCTTCCGG - Intergenic
903298765 1:22363227-22363249 TCCCCACACCCAGTGGTGCCTGG + Intergenic
903657635 1:24958998-24959020 TCCCCACCCATGGAGGAGTCCGG + Intronic
904238680 1:29130112-29130134 ACCCCAACCCCTGAGGCATCTGG - Intergenic
904296484 1:29522521-29522543 TCCCCACACCCAGAGGTGAAAGG - Intergenic
905303216 1:36999509-36999531 TCACCACCCACAGAGGCCTGAGG + Intronic
905871673 1:41407912-41407934 TCCCCTCCCCCACAGGAGGCTGG - Intergenic
906033687 1:42738355-42738377 GCCCCAGCCCCAGTGGCCTCGGG - Intronic
908767507 1:67567727-67567749 TCCCCACCCCCAGTGGAGTTAGG - Intergenic
913626453 1:120664987-120665009 TCCCCTCCCCCAGAGCCCTTAGG - Intergenic
915606020 1:156951421-156951443 TCCCCACCCCCAGTATCTTCAGG - Intronic
916502268 1:165397107-165397129 TCCCCACCCCCAGGGACATTTGG - Intergenic
920144966 1:203852175-203852197 TCCTCACCCCCGGAGGTGTCTGG + Exonic
921259690 1:213374835-213374857 GCCCCCCTCCCAGAGGCCTCTGG - Intergenic
921343518 1:214158170-214158192 ACCCCACTTCCAGAGGCGCCTGG - Intergenic
921820342 1:219609829-219609851 TCCTCACCCCCGGAGGTGTCTGG - Intergenic
922547707 1:226471089-226471111 TGCCCAGGCCCAGAGGCGACAGG + Intergenic
923097780 1:230789099-230789121 TCCCCAGGCCCAGAGGCTTCAGG + Intronic
1062816614 10:505689-505711 TCCCCATCTCCTGTGGCGTCAGG - Intronic
1063053359 10:2477012-2477034 TCAACACCCCCAGAGACGTCTGG - Intergenic
1064965925 10:21015201-21015223 TTCCCACCCCCAGAGCCTTAAGG - Intronic
1065874772 10:29987740-29987762 TTCCCACCCCCAAAGGCTTCTGG + Intergenic
1066361981 10:34740111-34740133 TCCCCACCCCAAGAGGAGAAAGG + Intronic
1067084065 10:43228996-43229018 GACCCATCCCCAGAGGCGTAAGG - Intronic
1067112190 10:43408646-43408668 TCCCCACCCCCAGGGGGACCCGG + Intronic
1069929683 10:71874097-71874119 TCCCCACCCACAGGGGCTGCAGG - Intergenic
1070330025 10:75409788-75409810 CCCCCAACCCCGGAGGCCTCGGG + Intergenic
1070368263 10:75757233-75757255 TCCCCATTCCCAGGGGCCTCAGG + Intronic
1070756446 10:78996534-78996556 CCCCCACCCCCAGCGGCAGCCGG + Intergenic
1073058175 10:100715294-100715316 TCCCCACCCCAAGTGGCTTAGGG + Intergenic
1073345098 10:102776933-102776955 ACCCCTTCCCCTGAGGCGTCGGG - Intronic
1074537151 10:114336679-114336701 CCCCCACCCTCAGAGGCTCCAGG - Intronic
1075380349 10:122013681-122013703 TCCCCAGCCACAGAGGGCTCGGG - Intronic
1076406918 10:130218598-130218620 GCCCCTCCCACAGAGGCTTCTGG - Intergenic
1077140169 11:1020776-1020798 TCCCCACCCCGTGGGGCCTCTGG + Intronic
1077988700 11:7381914-7381936 TCCCCTCCTCCAAAGGCTTCTGG - Intronic
1078011249 11:7574704-7574726 ACCCCACCCCCAGGGGCAGCTGG - Intronic
1079430906 11:20387705-20387727 TCCCCGCCCCCAGACACGCCGGG + Exonic
1081736555 11:45408545-45408567 TCCCCAGCCCCAGAGTGGCCTGG + Intergenic
1081872690 11:46390758-46390780 TGCCCACGCCCAGAGGCTGCAGG - Intergenic
1081967517 11:47178570-47178592 TCCCTACCCCCAGAGGCACCTGG + Intronic
1082810210 11:57474967-57474989 GCTCCACCCCCAGAGGCGGCAGG - Intronic
1083881904 11:65553101-65553123 TCCCCACCCCCAGTGATGGCTGG + Intronic
1084416562 11:69035925-69035947 CCCCCAACCCCACAGGCCTCTGG + Intergenic
1086431778 11:86743154-86743176 ACCCCACCCCCACAGTCCTCTGG - Intergenic
1086905411 11:92412888-92412910 TCCCCACCACCAGAGTGGTATGG + Intronic
1088048749 11:105484694-105484716 TCCCCACACCAAGAGGCATCTGG - Intergenic
1089494995 11:118903308-118903330 CCCCCGCCCCCAGGGGCATCAGG + Exonic
1089498601 11:118920015-118920037 TCCCCACCCCCAGTGGCCTCTGG - Intronic
1089605679 11:119639986-119640008 GCCCCGCCCCCAGAGGGGTCTGG - Intronic
1090972180 11:131653367-131653389 TCCCCTCCCCCAGGGCCCTCCGG - Intronic
1091224133 11:133947398-133947420 TCCCCAGCCCCAGACCCTTCTGG + Intronic
1094182374 12:27605353-27605375 TCCCTACCCCCAGGGGCTCCTGG - Intronic
1096717280 12:53499245-53499267 TTCCCAGCCCCACAGGCGTCGGG + Intronic
1097195876 12:57242330-57242352 CCCCCACCCCCTCAGGCATCCGG + Intergenic
1098550415 12:71755327-71755349 TCCCCAGCCCCGGAGGGGTAGGG - Intronic
1103856367 12:123973225-123973247 TCCGCACACCCAGACGCCTCCGG - Exonic
1103896130 12:124274472-124274494 TCCCCTCCCCCAGAAGGGCCTGG - Intronic
1104205887 12:126638132-126638154 TCCCTGCCCCAAGAGGAGTCTGG + Intergenic
1106081772 13:26506393-26506415 ACCCCACCCCCAGTGGCACCTGG + Intergenic
1106693022 13:32139362-32139384 TCCCCAGCCACAGATGCTTCAGG + Intronic
1107560316 13:41551995-41552017 TCCCCACACCCAGACTCCTCAGG + Intergenic
1110450687 13:75635783-75635805 TCCCCGCCCCCTGCGGCGGCCGG - Intronic
1111168367 13:84492146-84492168 TTCCCACCCACAGAGGGGTTAGG + Intergenic
1112497274 13:99915157-99915179 TCCCCAGCCCCACAGGGCTCAGG + Intergenic
1113369474 13:109709743-109709765 TCCCCACCCCCAGTGGTCTGTGG + Intergenic
1113458996 13:110468663-110468685 TCCCCTTCCCAAGAGGCGCCAGG + Intronic
1114549633 14:23525509-23525531 TCCCCACCCCCGAGGGCCTCAGG + Exonic
1114613616 14:24057097-24057119 TCGCCACCCCCAGAGGCCATGGG - Intronic
1115024131 14:28720344-28720366 TCACCACCCCCAAAGTCATCTGG - Intergenic
1117630252 14:57683853-57683875 ACCCCAACCCCAGAGGAGTTGGG - Intronic
1118774537 14:68965544-68965566 TCCCCACCCCCAGACACACCTGG + Intronic
1119409779 14:74423258-74423280 ACCCCACTCCCAGAGCTGTCAGG - Intronic
1120722721 14:87905756-87905778 TCAGCACCCCCAGAGACCTCAGG + Intronic
1122387209 14:101357244-101357266 TCCCCACCCCCACCGCCTTCGGG + Intergenic
1122792103 14:104188336-104188358 TCTCCAGCCCCAGGGGCGGCGGG + Intergenic
1122815958 14:104314218-104314240 CCCCCAGCCTCAGAGGCCTCAGG - Intergenic
1122884682 14:104705775-104705797 TCCCCTTCCCCAGGGGCGTGCGG + Intronic
1125674785 15:41496057-41496079 TCCCCACCCCCAGGCCCGCCGGG + Intronic
1129108307 15:73323430-73323452 TCCCCACCCCCCGGGGCCTGTGG - Exonic
1129327588 15:74809355-74809377 TCCCTACCCCCATAAGCCTCAGG - Intergenic
1130031134 15:80315258-80315280 TCCCCACCCTCAAAGGCCACAGG - Intergenic
1132463042 16:64814-64836 TGCCCAGCCCCTGAGGCGACAGG - Exonic
1133270965 16:4610620-4610642 TCCCCAGCCTCAGAGGAGCCTGG - Intronic
1138096157 16:54213570-54213592 TCCCCACCCCCAGACTCTCCTGG - Intergenic
1140223015 16:73057952-73057974 GCCCCACCCCGAGAGGCGCCGGG - Intronic
1142225657 16:88876365-88876387 GCCCCTCCCCCAGGGGCGTGAGG - Exonic
1143090236 17:4445748-4445770 GCCCCACCCCCAGCAGAGTCGGG - Intronic
1143248543 17:5505263-5505285 GCCCCACCCTGAGAGGCTTCTGG + Intronic
1143410783 17:6707201-6707223 TCCCCACCCCCAGAACACTCCGG + Intronic
1144776025 17:17785000-17785022 TCCCCACCCCCATGGGCCCCTGG + Intronic
1144835964 17:18156891-18156913 ACCCCACTCCCAGAGGCCTAGGG - Intronic
1144957974 17:19029045-19029067 TCCCCTCACCCAGAGGAGTGGGG - Intronic
1144977184 17:19145475-19145497 TCCCCTCACCCAGAGGAGTGGGG + Intronic
1146280218 17:31539883-31539905 TCCCCTCCCCCAGGAGCGTGGGG - Intergenic
1146367521 17:32240480-32240502 TCTCCAGCCCCAGAAGCGTGAGG - Intronic
1147192062 17:38743778-38743800 TCCCCACCCCAGGAGGCCCCAGG + Intronic
1147266582 17:39238010-39238032 TCCCCATCTCCAGAGGAGCCCGG - Intergenic
1148695439 17:49555671-49555693 TCCCCACGCCCAGAGCTGGCCGG - Intergenic
1149204333 17:54226657-54226679 TCTCCATCCCCAGAGTTGTCTGG + Intergenic
1150456847 17:65313144-65313166 TCCCCACCCCCAGAGCGATAAGG + Intergenic
1152335179 17:79696634-79696656 GCCCCACCCCCACAGGCCTAGGG + Intergenic
1152467158 17:80472961-80472983 TACCCACCCCAGGAGGCATCCGG + Intronic
1152616149 17:81338791-81338813 CCCACACCCCCACAGGCATCTGG - Intergenic
1154445316 18:14431139-14431161 TCCTCACCCCCAGAGGAGACGGG + Intergenic
1156261091 18:35445472-35445494 TCCCTACCCCCACAGGAGTCAGG - Intronic
1157566743 18:48683619-48683641 ACCCCACCCCCAAAGGGTTCAGG + Intronic
1160017989 18:75158699-75158721 TCCTCACCCCCAGCAGCCTCAGG - Intergenic
1160344981 18:78124877-78124899 TCCCCACCCCCACAGGTGTGGGG + Intergenic
1160410358 18:78671550-78671572 CCCCCACCCCGAGAGCCGTGCGG - Intergenic
1160680256 19:408935-408957 CCCCCACCCCAAGCGGAGTCGGG - Intronic
1161163242 19:2772136-2772158 TCCCCAGCTCCTGAGGCCTCAGG - Intronic
1162796091 19:13088372-13088394 TCCCGCCCCCCAGAGGGGCCTGG - Intronic
1162913394 19:13861956-13861978 TTCCCACGCCCTAAGGCGTCTGG + Intergenic
1163635067 19:18433836-18433858 TCCCCCCCCGCGGCGGCGTCGGG + Intronic
1165316581 19:35059958-35059980 GCCCCACACCCAGAGGCTGCTGG + Exonic
1165741294 19:38206713-38206735 TCCCCACACCCAGAGAGGTGAGG + Exonic
1165908999 19:39212429-39212451 TCCCCACCCGCAGGGGCTCCTGG - Intergenic
1166302622 19:41921108-41921130 TCCCCTCCCCCAGAGCTGTTTGG - Intronic
1166317768 19:41998505-41998527 TCCCCACCTCCAGAAGCGTGGGG + Exonic
1166337409 19:42116791-42116813 TCACCCCCCCCAGAGGAGGCTGG + Intronic
1166948965 19:46413701-46413723 TCCCCTCCCCCACAGGGGTGTGG + Intergenic
1167352423 19:48983900-48983922 TCACCACCCCCACAGCCTTCTGG + Intronic
1168643812 19:58047152-58047174 CGCCCACCCTCAGAGGCGTCAGG + Intronic
925315790 2:2922159-2922181 TCCCCAGCCCCACAGGCCACAGG + Intergenic
927863810 2:26576382-26576404 TCCCCACCTCCCGGGGCTTCAGG + Intronic
928463250 2:31495622-31495644 TCCCCACCCCGACAGGCCCCAGG - Intergenic
932556618 2:72830195-72830217 TTCCCACCCACAAAGGGGTCAGG + Intergenic
932731672 2:74226257-74226279 TCCCCTACCCCAGAGCCCTCAGG + Intronic
933649596 2:84839990-84840012 TCCCCACCCCCTCAGCTGTCTGG + Intronic
933869897 2:86555920-86555942 TCCCCACCCCCAAAGAGATCAGG - Intronic
934559328 2:95304505-95304527 TCCCCACTGCCAGAGACCTCAGG + Intronic
934561323 2:95314999-95315021 TGCCCACCCCCAGAGGCAGCTGG - Intronic
935560389 2:104552869-104552891 TCTCCACCTTCAGAGGAGTCTGG - Intergenic
937080133 2:119134846-119134868 GCCTCACCCCCAGAAGCCTCTGG + Intergenic
941367087 2:164621746-164621768 TCCCCGCCTCCAGCGGCGCCGGG - Exonic
944840632 2:203620605-203620627 CCCCCACCCCCTGGGGCCTCAGG + Intergenic
949005158 2:241641806-241641828 TCCACACCCGCAGAGGCCTTTGG - Intronic
1170128143 20:12988503-12988525 TCCCCACCTCCAGAGGTGATGGG - Intergenic
1171771633 20:29326717-29326739 CCCACACACCCAGAGCCGTCAGG + Intergenic
1171813587 20:29763950-29763972 CCCACACACCCAGAGCCGTCAGG + Intergenic
1172764030 20:37341569-37341591 TCCCCAACCCCATGGGAGTCAGG - Intergenic
1173947853 20:46965707-46965729 GCGCCAACCCCAGAGGAGTCAGG - Intronic
1174317361 20:49713385-49713407 TCCGCACCCCAACAGGCGCCCGG - Intronic
1174338948 20:49884074-49884096 GCCCCACCCCCACAGGCGCATGG - Intronic
1174867661 20:54152674-54152696 CATCCACCCCCAGAGGCCTCTGG - Intergenic
1175900235 20:62357157-62357179 TCCCCAACCCAAGATGGGTCAGG - Intronic
1175925807 20:62470828-62470850 TCCCTACCCTCCGAGGCCTCTGG + Intronic
1176236463 20:64055968-64055990 TCCCCTTCCCCAGAGGCCCCAGG - Intronic
1179711159 21:43263986-43264008 AACCCACCACCAGAGGCCTCAGG - Intergenic
1179884365 21:44307120-44307142 CCCCCACTCACAGAGGCCTCGGG - Intronic
1180866577 22:19122939-19122961 TCCCCACCCTCAGAACCGGCAGG - Intergenic
1182281174 22:29218532-29218554 TCCCCACCTCCTGAGGCCTGGGG - Intronic
1182366684 22:29783902-29783924 TCCCCACCCCCAGGGGAGGGGGG + Intergenic
1183710781 22:39502132-39502154 GCCCCGCCCCCAGAGGACTCCGG - Intronic
1184466604 22:44672182-44672204 TCCCCTGCCCCAGAGGAGTAGGG + Intronic
950446995 3:13044217-13044239 CCCCCACCCCCAGGGACATCTGG + Intronic
950540442 3:13609233-13609255 TCCCCACCCCCACAACGGTCGGG - Intronic
952839454 3:37631829-37631851 TCCCCACCCCTACAGGCTTCAGG + Intronic
953772998 3:45792977-45792999 TGTCCTCCCCCACAGGCGTCTGG + Intronic
954197095 3:49003376-49003398 CCCCCACCCTCAGAGGAATCTGG + Intronic
955065298 3:55528868-55528890 TCCCCACCCCCAGGGACATTTGG - Intronic
955350408 3:58189280-58189302 ACCCCACCCCCAGCAGGGTCAGG + Intergenic
955468179 3:59258066-59258088 GCCCCACCCCCAGAGATTTCAGG + Intergenic
960513250 3:118575499-118575521 AACCCACTCCCAGAGGCCTCTGG - Intergenic
962950690 3:140215958-140215980 TCCCCAACCCCTGGGGCCTCGGG + Intronic
963740000 3:149068928-149068950 TCCCCATCCCCAGTGGCCTGTGG - Intronic
967046863 3:185745495-185745517 TTCCCACCCCCAGAGGTGGCTGG + Intronic
967387999 3:188929224-188929246 TCCCCACCCCCACGGCCATCTGG + Intergenic
968664556 4:1814011-1814033 TGCCCACCCTCAGGGGCGTCAGG - Exonic
969304366 4:6317412-6317434 TCCCCACCCTCAGAGGTCCCTGG + Intergenic
969449525 4:7265040-7265062 GCCCCAACTCCAGAGGCATCGGG - Intronic
971873991 4:32280736-32280758 CCCCCACCCCCAGAAGGCTCTGG - Intergenic
976031272 4:80757796-80757818 TTCCCACCCACAAAGGGGTCAGG - Intronic
979024699 4:115554236-115554258 CCCCCAGTCCCAGAGGCGTGAGG - Intergenic
981081961 4:140644954-140644976 TCCCAAGCCCCAGGGGTGTCCGG + Intronic
983946351 4:173590064-173590086 TCCCCACCCTCACAGGCCCCTGG - Intergenic
985445032 4:190017199-190017221 CCCACACACCCAGAGCCGTCAGG - Intergenic
985491519 5:182388-182410 CCGCCACCCCCAGAGTCATCAGG - Exonic
988351002 5:30106851-30106873 TTCCCACCCACAAAGGGGTCAGG + Intergenic
989339319 5:40355549-40355571 TCACCACCCACAGAGGTTTCTGG + Intergenic
991063749 5:62404240-62404262 TTCCCACCCCCACAAGCTTCAGG - Intronic
997926228 5:138033159-138033181 TCCCCACCCCCACAGCATTCCGG + Intronic
999344320 5:150801822-150801844 TCCCCACCCCCAGAGAAGATAGG - Intergenic
1000276992 5:159746741-159746763 TCCCCACTCCCAGAGGGGCCAGG - Intergenic
1000548028 5:162625819-162625841 TCCCCACCCCCAATGGCACCTGG + Intergenic
1001097501 5:168787065-168787087 TCTTCACTCCCAGTGGCGTCTGG - Intronic
1002276428 5:178107117-178107139 CCCCCACCCCCAGGGGTGACTGG - Intergenic
1006305727 6:33217260-33217282 ACCCAACCCCCAGAGGCTACTGG + Intergenic
1007061986 6:38948994-38949016 TACCCACCCCCAGGGGCATTTGG + Intronic
1007414452 6:41683715-41683737 TCCACACCTCCAGCGGCGGCCGG - Intergenic
1008649436 6:53548028-53548050 GCCCCGCCCCCAGAGCCGTCCGG + Intronic
1009565295 6:65304733-65304755 TCCTCACCCCCGGAGGTGTCTGG + Intronic
1010495839 6:76533026-76533048 TCCTCAGCCCCAGAGGGGTTAGG + Intergenic
1012860041 6:104548427-104548449 TCTTCACCCCCAAAGGCTTCTGG + Intergenic
1018888759 6:167965744-167965766 TTCCCGCCCGCAGAGGCGACAGG + Intronic
1019017111 6:168888027-168888049 TCCCCACCCCCAGATGGGCCAGG - Intergenic
1019145074 6:169971074-169971096 TCACCAGCCCCCGGGGCGTCTGG - Intergenic
1019493011 7:1323822-1323844 TCCCCAGTACCAGAGGCGTTGGG + Intergenic
1019783516 7:2958863-2958885 TCCCCATCTCCAGGGGTGTCAGG - Intronic
1021477207 7:21075632-21075654 TCCCCACCCTCAGAGATGTCAGG - Intergenic
1022282524 7:28925523-28925545 TCCCCACCCTCAGAGGGCTCTGG - Intergenic
1024785641 7:52903978-52904000 TCCCCACCCCCAGCAGCCCCTGG - Intergenic
1024786418 7:52912132-52912154 TCCCCAGCCACAGAGGTTTCTGG + Intergenic
1029606521 7:101602527-101602549 TCCCAAGCCCCAGAGGCTTTGGG + Intergenic
1033361417 7:140640966-140640988 CCCCCACCCCGAGAGGCGAGGGG - Intronic
1033409558 7:141104897-141104919 CCCCTACCCCCAGAGACCTCAGG - Intronic
1034816378 7:154175465-154175487 ACCCCACCCCCAGAGCCTCCAGG + Intronic
1035477071 7:159151377-159151399 TCCCCACTGCCAGAGGTGGCTGG - Intergenic
1035741229 8:1929946-1929968 TGCCCACCCCCAGCGGCTGCGGG - Intronic
1036018921 8:4819885-4819907 TCCCCACCCCCAAAGTCCACAGG - Intronic
1036947126 8:13105102-13105124 TCTCCAGCCCCATAGGCCTCTGG - Intronic
1036949995 8:13131980-13132002 TCCCCACCTCCAGAGTCCTGGGG - Intronic
1037579743 8:20237273-20237295 TCCCCACCCCCACGGGCACCAGG - Intergenic
1038271754 8:26081319-26081341 TCCCCTCCTCCAGAGGCACCTGG + Intergenic
1038476282 8:27870746-27870768 TCCCCACCCCCAGAGGTTATAGG + Exonic
1039538844 8:38344761-38344783 TTCCCTCCCCCAGATGCCTCAGG - Intronic
1039846978 8:41332434-41332456 TCTCCACACCCAGAGGCTTCAGG + Intergenic
1039987734 8:42462066-42462088 TCCCCTCCCCCAGATTCGCCTGG - Intronic
1041300621 8:56407692-56407714 TCCCTCCCCTCAGAGGCGCCAGG - Intergenic
1042004480 8:64165996-64166018 TTCCCACCCACAGAGGGATCAGG + Intergenic
1043428460 8:80171563-80171585 TCCCCACCCCCAGAGGCGTCGGG + Intronic
1043639401 8:82432437-82432459 TCCCCAACCCCAAAGTCGTGGGG - Intergenic
1047508777 8:125500268-125500290 TCACCACACCCAGATGTGTCTGG + Intergenic
1050692801 9:8247506-8247528 CCCCCACCCCCAGAGTCATTGGG + Intergenic
1051265798 9:15307285-15307307 TCCCCGCCCCCGGAGCCGGCAGG + Exonic
1052790832 9:32874147-32874169 TCCCCCTCCCCAGAGGCATCAGG + Intergenic
1052997662 9:34559747-34559769 ACCCCACCCCCAGCGGTGGCAGG - Intronic
1053720203 9:40938233-40938255 TCTCCAACGCCAGAGGCGGCAGG + Intergenic
1055945282 9:81687817-81687839 TCCCCATTCCCAGAGTCGCCGGG + Intronic
1056126124 9:83537928-83537950 CCCCCACCCTCAGAGGCCTGAGG + Intronic
1057006754 9:91567753-91567775 TTCCCACCCACAGAGAGGTCAGG - Intronic
1057752528 9:97803888-97803910 TCCCCATCCCCAGCGGTGACGGG - Intergenic
1060796240 9:126514583-126514605 CTCCCACCCCCTGCGGCGTCCGG + Intergenic
1060806919 9:126583499-126583521 TCCCCACCCCCAGGGAGATCTGG - Intergenic
1060884384 9:127140304-127140326 TCCCAGACCCCAGAGCCGTCCGG + Intronic
1061257471 9:129460896-129460918 TCCCCACCCCCACAAGCCTTTGG + Intergenic
1061474533 9:130855498-130855520 TCCCCTCCCCCACAGACGCCTGG + Intronic
1061856316 9:133443644-133443666 TCCCCTCCTCCTGAGGCCTCCGG + Intronic
1188156488 X:26748673-26748695 TCCCCACCACCAAAGGAGTGGGG - Intergenic
1189152914 X:38726195-38726217 TCCCCACCCTCAGAAGTCTCAGG - Intergenic
1190534220 X:51409324-51409346 TCCCCACCCCCAAAGACCTCAGG - Intergenic
1191607355 X:63077424-63077446 TCCCCACCCCCAGGAATGTCAGG + Intergenic
1196602990 X:117623117-117623139 CCCCCCCCCCCAGTGGGGTCTGG - Intergenic
1197395632 X:125923363-125923385 TCCCCACCCCCATTGGCGCCTGG - Intergenic
1197726817 X:129781934-129781956 TCCCCAGGCCCAGAGGCAGCGGG + Intronic
1198189627 X:134288960-134288982 CCACCAGCCCCAGAGGCTTCTGG + Intergenic
1198310935 X:135425350-135425372 CGCCCACCCCCAGTGGCTTCTGG + Intergenic
1201610643 Y:15839636-15839658 TTCCCACCCACAAAGGGGTCTGG - Intergenic