ID: 1043428464

View in Genome Browser
Species Human (GRCh38)
Location 8:80171568-80171590
Sequence ACCCCCAGAGGCGTCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428453_1043428464 6 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428454_1043428464 3 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428457_1043428464 -10 Left 1043428457 8:80171555-80171577 CCGCGAAGTCCCCACCCCCAGAG 0: 1
1: 0
2: 3
3: 31
4: 316
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428449_1043428464 26 Left 1043428449 8:80171519-80171541 CCGCGCAGAGCTCCTCCTCGCCT 0: 1
1: 0
2: 0
3: 23
4: 406
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428451_1043428464 14 Left 1043428451 8:80171531-80171553 CCTCCTCGCCTCCGCCGGCGACT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428455_1043428464 0 Left 1043428455 8:80171545-80171567 CCGGCGACTCCCGCGAAGTCCCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428452_1043428464 11 Left 1043428452 8:80171534-80171556 CCTCGCCTCCGCCGGCGACTCCC 0: 1
1: 0
2: 4
3: 39
4: 342
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
1043428456_1043428464 -9 Left 1043428456 8:80171554-80171576 CCCGCGAAGTCCCCACCCCCAGA 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428464 Original CRISPR ACCCCCAGAGGCGTCGGGCG CGG Intronic
900302197 1:1983439-1983461 ACCCCCAGGGGCATCGAGCACGG + Intronic
902377236 1:16035506-16035528 ACCCCCAGAGAGGGAGGGCGAGG - Intergenic
904039296 1:27575177-27575199 AGCCCCAGAGGCGGCGGCGGCGG - Intronic
906727076 1:48051884-48051906 ACACCCAGAGGCCTGGGGAGGGG - Intergenic
907896846 1:58700197-58700219 GCCCCCAGAGGCCTGGGGCTTGG + Intergenic
914796287 1:150923301-150923323 AACCCCAGAGGCGTAGGTTGTGG + Intergenic
919878739 1:201888864-201888886 ACCCCCAGAGGAGGCGGAAGAGG + Exonic
923014054 1:230112363-230112385 GCCTCCAGAGGCGCCGGGGGAGG + Intronic
923683996 1:236142028-236142050 ATCCCCCGAGGCGCGGGGCGCGG + Intergenic
1063174507 10:3539485-3539507 AGCCCCAGAGGCGGCGGCAGTGG + Intergenic
1076013575 10:127009868-127009890 AGACCCAGAGGAGTCGGGTGGGG - Intronic
1077044746 11:539806-539828 ACCCTCAGAGGCCTGGGGAGGGG + Intronic
1077635163 11:3837205-3837227 ACCCCCTCAGGCCTCGGGCGGGG - Intronic
1082810206 11:57474962-57474984 ACCCCCAGAGGCGGCAGGGGAGG - Intronic
1084412368 11:69012305-69012327 AGCCCCAGCGGCGTCGGGGCTGG - Intronic
1086227266 11:84527066-84527088 ACCCCCAGTGGGGCCGGGAGCGG - Intronic
1092163651 12:6329680-6329702 ACCACGAGAGGCGGAGGGCGCGG - Intronic
1101910326 12:108856651-108856673 AACTCCAGAGGCGGCAGGCGGGG + Intronic
1105577812 13:21669928-21669950 ATCCCCAGTGGCGGCGGGCGCGG - Intergenic
1113246584 13:108403100-108403122 AACCCCAGAGGAGTTGGGGGTGG + Intergenic
1113785383 13:112999681-112999703 ACGCCCAGAGGCCTCAGGCTTGG - Intronic
1117630248 14:57683848-57683870 AACCCCAGAGGAGTTGGGCTTGG - Intronic
1122486634 14:102086687-102086709 GCCCCCAGCGGGGCCGGGCGGGG + Intronic
1128231598 15:66039292-66039314 ACTCCCAGAGGTGGCGGGAGAGG + Intronic
1132314375 15:100879663-100879685 TCCCGCAGGGGCGGCGGGCGGGG + Exonic
1132488651 16:212001-212023 AGCCGCAGAGGGGCCGGGCGCGG + Intronic
1139090448 16:63640065-63640087 ACCTCCAGAGGCATCTGGTGAGG + Intergenic
1139473892 16:67192905-67192927 CCACCCAGAAGTGTCGGGCGTGG + Intronic
1141945568 16:87307048-87307070 ACCCCCAGAGGCAGGGGTCGGGG - Intronic
1142044064 16:87913945-87913967 ACCACAAGAGGCGTGGGGAGCGG + Intronic
1142393096 16:89815772-89815794 AACACCCGAGGCGGCGGGCGCGG - Intronic
1148562335 17:48613231-48613253 GGCCCCAGAGGCGGCGGACGAGG - Exonic
1151856656 17:76726680-76726702 ACCGCGAGAGGCGTCGGGGCGGG - Intronic
1152335183 17:79696639-79696661 ACCCCCACAGGCCTAGGGCAAGG + Intergenic
1152408793 17:80111825-80111847 CCCCACAGAGGCGTGGGGAGCGG + Intergenic
1152545759 17:80999433-80999455 AGCACCAGAGGCGTTGGGCCTGG - Exonic
1152585951 17:81189523-81189545 ACCCCCAGAGCAGCCAGGCGTGG - Intergenic
1161388017 19:4007339-4007361 ACTCCCGGCGGCGTCGGGCAGGG - Intergenic
1161443345 19:4304786-4304808 GCCCGCAGGGGCGTCGGGGGCGG + Intronic
1167358145 19:49016478-49016500 ACCCACAGAGGCAGCGGGGGAGG - Intronic
1167359640 19:49023368-49023390 ACCCACAGAGGCAGCGGGGGAGG - Intronic
1167361491 19:49032717-49032739 ACCCACAGAGGCAGCGGGGGAGG + Intronic
1167362163 19:49036068-49036090 ACCCACAGAGGCAGCGGGGGAGG - Intronic
1167363921 19:49044790-49044812 ACCCACAGAGGCAGCGGGGGAGG + Intronic
1167364577 19:49048137-49048159 ACCCACAGAGGCAGCGGGGGAGG - Intronic
1167365862 19:49054773-49054795 ACCCACAGAGGCAGCGGGGGAGG - Intronic
925412390 2:3647499-3647521 ACCCCCAGCGGCATCGGGAGAGG - Intergenic
925412420 2:3647601-3647623 ACCCCCAGGGGCATCAGGAGAGG - Intergenic
925412431 2:3647635-3647657 ACCCCCAGGGGCATCAGGAGAGG - Intergenic
925412442 2:3647669-3647691 ACCCCCAGGGGCATCAGGAGAGG - Intergenic
925412451 2:3647703-3647725 ACCCCCAGGGGCATCAGGAGAGG - Intergenic
926394186 2:12424331-12424353 ACCCCCAGAGGCTAAGGGAGAGG - Intergenic
929539592 2:42810003-42810025 CCCCCCAGTGGCGGCTGGCGGGG - Intergenic
933899074 2:86836309-86836331 ACCCCCACAGGCCTCGGCCCTGG + Intronic
934921372 2:98347396-98347418 GCCCCCAGGGGCGTCGGGAGGGG - Intronic
939313235 2:140511589-140511611 ACCCCTAGAGGGGCTGGGCGCGG - Intronic
946966390 2:225042103-225042125 GCCCGCAGAGGCGGCGGGGGAGG + Intronic
947754323 2:232550793-232550815 AGCCCCAGCGGGGGCGGGCGCGG - Intronic
1180074316 21:45455090-45455112 ACGCCCAGAGGCGCCTGGCCTGG - Intronic
1180260875 21:46667900-46667922 AGCCCGCGAGGCGTCGGGAGAGG + Intergenic
1181486329 22:23234034-23234056 ACCCCCAGAGGACTCGGCCTGGG - Intronic
951652113 3:24962217-24962239 ACACCCAAAGGGGCCGGGCGAGG - Intergenic
952120267 3:30233692-30233714 ACCCCCAAAGGGGTTGGGAGTGG - Intergenic
956468635 3:69542622-69542644 CCCCGGAGAGGCGGCGGGCGGGG - Intergenic
961213243 3:125141540-125141562 GCCCCCAGCGGCGTAGGGGGAGG - Intronic
966183152 3:177204849-177204871 ACACCAGGAGGCGCCGGGCGCGG + Intergenic
966743339 3:183253874-183253896 ACCCAGAGAGGCCTCGGCCGCGG - Intronic
968341568 3:197960168-197960190 ACCCCCAGCGGCGAGGGGCGGGG + Intergenic
973759628 4:54104153-54104175 AGCCCCAGAGGGGCCGGGCTGGG - Intronic
985491517 5:182383-182405 ACCCCCAGAGTCATCAGGCCTGG - Exonic
1001617916 5:173057066-173057088 CGCCTCAGAGGCGACGGGCGAGG + Intronic
1020281757 7:6653487-6653509 CCCCCCAGGGGCGCCGGGAGCGG - Exonic
1028223121 7:88219808-88219830 AACCCCAGGGGCCTAGGGCGAGG + Intronic
1034964721 7:155384033-155384055 CCCCCCAGAGAAGGCGGGCGTGG - Intronic
1038499172 8:28029214-28029236 ACCCCGAGAGGCTCCGGGGGAGG - Intronic
1039891660 8:41689862-41689884 AACCTCAGAGGCCTCGGGCCAGG + Intronic
1043428464 8:80171568-80171590 ACCCCCAGAGGCGTCGGGCGCGG + Intronic
1049438414 8:142598228-142598250 AACCCCAGAGGAGGAGGGCGGGG - Intergenic
1049651315 8:143771239-143771261 ATCCCCGGCGGCGTGGGGCGGGG + Intergenic
1061010363 9:127950955-127950977 ACCCCCACAGGGGTTGGGAGGGG + Intronic
1062596456 9:137302048-137302070 GCGCCCAGAGGCGGCGTGCGGGG - Exonic
1185461312 X:333826-333848 GCACCCCGAGGCGTCTGGCGTGG + Intergenic
1191997053 X:67106665-67106687 ACCCCCAAAGGTGTTGGGAGGGG - Intergenic
1198310938 X:135425355-135425377 ACCCCCAGTGGCTTCTGGTGTGG + Intergenic