ID: 1043428468

View in Genome Browser
Species Human (GRCh38)
Location 8:80171571-80171593
Sequence CCCAGAGGCGTCGGGCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 279}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428449_1043428468 29 Left 1043428449 8:80171519-80171541 CCGCGCAGAGCTCCTCCTCGCCT 0: 1
1: 0
2: 0
3: 23
4: 406
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428454_1043428468 6 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428456_1043428468 -6 Left 1043428456 8:80171554-80171576 CCCGCGAAGTCCCCACCCCCAGA 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428455_1043428468 3 Left 1043428455 8:80171545-80171567 CCGGCGACTCCCGCGAAGTCCCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428452_1043428468 14 Left 1043428452 8:80171534-80171556 CCTCGCCTCCGCCGGCGACTCCC 0: 1
1: 0
2: 4
3: 39
4: 342
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428453_1043428468 9 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428451_1043428468 17 Left 1043428451 8:80171531-80171553 CCTCCTCGCCTCCGCCGGCGACT 0: 1
1: 0
2: 0
3: 14
4: 149
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279
1043428457_1043428468 -7 Left 1043428457 8:80171555-80171577 CCGCGAAGTCCCCACCCCCAGAG 0: 1
1: 0
2: 3
3: 31
4: 316
Right 1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 0
3: 29
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428468 Original CRISPR CCCAGAGGCGTCGGGCGCGG CGG Intronic
901086501 1:6614631-6614653 CCGAGAGCCGTAGGGGGCGGGGG - Intronic
901205686 1:7494514-7494536 CCAAGAGGGGCCGGGTGCGGTGG + Intronic
901317573 1:8318991-8319013 GCATGAGGGGTCGGGCGCGGTGG + Intronic
902511060 1:16967392-16967414 GCCAGAGGCCTTGGGGGCGGGGG - Intronic
902916815 1:19644484-19644506 TCCAGAGGCTTCGGCCGCGGGGG + Intronic
904039293 1:27575174-27575196 CCCAGAGGCGGCGGCGGCGGCGG - Intronic
904374770 1:30073494-30073516 CCCAGAGGCAGCAGGTGCGGGGG + Intergenic
904837572 1:33349378-33349400 TCCAGGGGCGACGGGCGCGCAGG + Intronic
905408393 1:37752823-37752845 CGCAGGGGCGGCAGGCGCGGTGG + Intronic
905692700 1:39955009-39955031 CACAGAGCCGCCGGGCGAGGCGG + Intergenic
905757481 1:40523301-40523323 CCCAGAGGGGCCAGGCACGGTGG - Intergenic
908944573 1:69478325-69478347 GACAGAGGGGCCGGGCGCGGTGG - Intergenic
912616227 1:111102494-111102516 GCCAGAGGAGTGGGGCGAGGTGG - Intergenic
912922833 1:113885753-113885775 CCCAGATGGGCCAGGCGCGGTGG + Intronic
915238403 1:154502256-154502278 CTCGGAGGCGGCGGGCGCCGGGG + Intronic
917991813 1:180387886-180387908 CCCAGAGAAGCCGGGCACGGTGG + Intronic
921060194 1:211578780-211578802 CCCACAGGCGCGGGGCTCGGCGG - Intergenic
921199318 1:212790312-212790334 GCAAAAGGGGTCGGGCGCGGTGG - Intronic
921637702 1:217515381-217515403 AGCAGAGGAGTCGGGCGCGGTGG - Intronic
921882719 1:220272517-220272539 CCCAGGCGCCTAGGGCGCGGGGG + Intergenic
922925166 1:229342255-229342277 GTCAGAGTCGTCGGGCGCCGGGG - Exonic
922958588 1:229625910-229625932 CCCGGAGGCGGCGGCGGCGGGGG - Exonic
923014058 1:230112366-230112388 TCCAGAGGCGCCGGGGGAGGGGG + Intronic
923490411 1:234478911-234478933 CCCGGAGGCGGCGCGCGAGGTGG - Exonic
923699019 1:236282157-236282179 CCCCGAGGCCTCGGGCTCCGCGG + Intergenic
1063288533 10:4716130-4716152 CCCAGAAGCGTGGAGGGCGGGGG - Intergenic
1068996861 10:63216421-63216443 TCCATAGGAGCCGGGCGCGGTGG + Intronic
1069019185 10:63466134-63466156 TCCAGAGGCGGCGGCGGCGGCGG + Intergenic
1070302097 10:75210965-75210987 CCCAGGGGCCTAGGCCGCGGCGG + Intronic
1070609973 10:77926540-77926562 CCGGGAGGCGTCCGGCGGGGCGG - Intergenic
1072089638 10:92115042-92115064 CCCGGCGGCCGCGGGCGCGGGGG + Intronic
1072151682 10:92689695-92689717 CCCAGGGGCGACAGCCGCGGCGG + Intergenic
1072641091 10:97211740-97211762 CTCACAGCCGCCGGGCGCGGTGG + Intronic
1072804798 10:98417590-98417612 CCCAGAGGCGCCGGGCCAGCTGG + Exonic
1073244277 10:102078482-102078504 CCCAGAGTCGTTGGGCACAGTGG + Intergenic
1073334198 10:102692981-102693003 CACAGAGGGGCCGGGTGCGGTGG - Intronic
1075801829 10:125159338-125159360 CCCGGCGGCGGCGGGCGAGGAGG + Intronic
1076765489 10:132630789-132630811 CCGGGAGGCGGCGGGGGCGGCGG + Intronic
1076919994 10:133446352-133446374 GCCCGAGGCGGGGGGCGCGGTGG - Intergenic
1077324247 11:1956915-1956937 CCCAGAGGCGTCGGGAGGAATGG + Intronic
1077410280 11:2400630-2400652 CCGACAGGCGTCGGGAGCGGCGG + Exonic
1078530179 11:12131004-12131026 CCCAGTAGGGCCGGGCGCGGTGG + Intronic
1079474282 11:20812719-20812741 AGCAGAGGGGCCGGGCGCGGTGG + Intronic
1083457177 11:62786965-62786987 CTCAGAGGCGGCGGGCCCAGAGG - Exonic
1083598022 11:63928833-63928855 AACAGAGGCGCCGGGCGCGGTGG + Intergenic
1083885743 11:65572687-65572709 GGCAGAGGCGCCGGGCGGGGCGG + Exonic
1083922067 11:65786588-65786610 CCCAGGAGCCTCGGGCGCGCCGG + Intergenic
1083947281 11:65931284-65931306 CCAAGAGAGGCCGGGCGCGGTGG - Intergenic
1084069013 11:66721756-66721778 CCCAGATTTGTTGGGCGCGGTGG + Intronic
1085197972 11:74683657-74683679 CCGAGAGGCGGGGGCCGCGGTGG - Intergenic
1085279910 11:75323329-75323351 CCTAGAGGGGCCGGGCGTGGTGG + Intronic
1086227262 11:84527063-84527085 CCCAGTGGGGCCGGGAGCGGTGG - Intronic
1087565101 11:99845657-99845679 CCAAGAAGGGCCGGGCGCGGTGG - Intronic
1202807233 11_KI270721v1_random:12110-12132 CCCAGAGGCGTCGGGAGGAATGG + Intergenic
1096741910 12:53699673-53699695 CCCAGAGGCGGCTGCAGCGGTGG + Intergenic
1097019087 12:56007538-56007560 CTCAGAGGCGGCGGTGGCGGCGG - Intergenic
1103530150 12:121595522-121595544 GCCACAGCCGCCGGGCGCGGTGG - Intergenic
1103574564 12:121867807-121867829 GCCAGTGGTGTCGGGCACGGTGG - Intergenic
1103595507 12:122022425-122022447 CCCGGAGGCGGCGGGCGCCGGGG + Intronic
1103775651 12:123364758-123364780 ACCAGAGGCGACTGGAGCGGAGG + Intronic
1103856008 12:123972226-123972248 CCCCGCGGGGGCGGGCGCGGGGG + Intronic
1104857238 12:131907981-131908003 CACAGTGCCGGCGGGCGCGGGGG + Intronic
1105236852 13:18564558-18564580 CTCAGAGCGGCCGGGCGCGGTGG - Intergenic
1105943534 13:25171174-25171196 CCCAGAGCCGCAGGGCCCGGCGG - Exonic
1112402305 13:99087052-99087074 CGCAGAGGCCCCGGGCGCAGAGG - Intergenic
1112507812 13:99985445-99985467 CCCAGCGGCGGCGGCAGCGGCGG + Exonic
1112752554 13:102597214-102597236 CCCCGAGGGCCCGGGCGCGGGGG + Intronic
1113246587 13:108403103-108403125 CCCAGAGGAGTTGGGGGTGGAGG + Intergenic
1113493893 13:110713494-110713516 TCCAGAGGCGAGGGTCGCGGAGG - Intronic
1113771464 13:112911673-112911695 CCCCGAGGCCGAGGGCGCGGCGG + Intronic
1115398557 14:32934809-32934831 CCCAGAGCCGCCGCGCCCGGGGG + Intergenic
1116824458 14:49658361-49658383 ACCAGAGGGGCCGGGCGCGGTGG - Intronic
1117063935 14:51989817-51989839 CCCAGAGGAGAGGGGCCCGGAGG - Intronic
1119834862 14:77739845-77739867 TACAGAGGGGCCGGGCGCGGTGG + Intronic
1120762926 14:88302420-88302442 CCCAGAGCGGCCAGGCGCGGTGG + Intronic
1121308823 14:92923848-92923870 CCCAGAGGTGGGGGGGGCGGGGG - Intronic
1121959675 14:98247772-98247794 CCTTGAGGGGCCGGGCGCGGTGG - Intergenic
1122153679 14:99737977-99737999 CCCCCAGGCGTCGGGCAAGGAGG - Intronic
1122982163 14:105196784-105196806 CCCCGCGGCGCCCGGCGCGGGGG + Intergenic
1124640032 15:31391610-31391632 CCCGGAAGCGTCGGGGGCGGGGG - Intronic
1124640370 15:31392832-31392854 CCCGGAAGCGTCGCGGGCGGGGG - Intronic
1126626100 15:50686927-50686949 CCCAGAGGCGGTCGGCGTGGCGG - Intergenic
1127166093 15:56245354-56245376 CCAAGAGGCCCCGGGGGCGGGGG - Intronic
1128089763 15:64911706-64911728 CCCGCCGGCCTCGGGCGCGGAGG + Intronic
1129397262 15:75258792-75258814 CCCAGAGGCGCCGGGGTAGGGGG - Intronic
1129860325 15:78855535-78855557 TCCAAAGGGGCCGGGCGCGGTGG + Intronic
1129906334 15:79190281-79190303 CCCAGAGGAGTCAGGAGCCGAGG + Intergenic
1129951911 15:79599507-79599529 CACAGAGGGGCCGGGCGCGGTGG + Intergenic
1130239265 15:82170399-82170421 TCCAGTGGGGCCGGGCGCGGTGG - Intronic
1131569382 15:93518740-93518762 CCCAGTGGGGCCGGGCACGGTGG - Intergenic
1131635752 15:94231542-94231564 CCCTGACGCGGCGGGGGCGGGGG - Intronic
1132314378 15:100879666-100879688 CGCAGGGGCGGCGGGCGGGGCGG + Exonic
1132488653 16:212004-212026 CGCAGAGGGGCCGGGCGCGGTGG + Intronic
1133007694 16:2893923-2893945 CCCAAAGGGGCCGGGCGCGGTGG - Intronic
1133018386 16:2955273-2955295 CCCACAGGTGTCAGGCGTGGAGG - Intergenic
1136079856 16:27844854-27844876 CCCAGTGGGGTGGGGGGCGGTGG - Intronic
1140552497 16:75881974-75881996 CCCAGTGTTGCCGGGCGCGGTGG - Intergenic
1140711011 16:77677683-77677705 CCCAGTGGGGCCGGGTGCGGTGG + Intergenic
1142044066 16:87913948-87913970 ACAAGAGGCGTGGGGAGCGGCGG + Intronic
1142393095 16:89815769-89815791 ACCCGAGGCGGCGGGCGCGGTGG - Intronic
1142651602 17:1356980-1357002 CCAAAAGGGGCCGGGCGCGGTGG + Intronic
1142685964 17:1577149-1577171 CCCAGCAGGGCCGGGCGCGGTGG - Intronic
1142715867 17:1746712-1746734 CCAGGAGGGGCCGGGCGCGGTGG - Intronic
1143291569 17:5835276-5835298 CTCAGAGGGGCCAGGCGCGGTGG - Intronic
1143560751 17:7693026-7693048 CCAAGAGGGGCTGGGCGCGGTGG - Intronic
1144253229 17:13440362-13440384 CACAGAGGGGCCGGGCGTGGTGG + Intergenic
1144483214 17:15644475-15644497 CCAAAAGGCATCAGGCGCGGTGG - Intronic
1144485455 17:15660609-15660631 TACAGAGGGGCCGGGCGCGGTGG + Intronic
1145912948 17:28552737-28552759 CCGAAATGCGACGGGCGCGGGGG + Intronic
1147110186 17:38256549-38256571 CCCAGAAGGGTCCGGGGCGGGGG + Intergenic
1147464834 17:40603103-40603125 CTCAGAGGAGTCGGGAGCTGCGG + Intergenic
1147486429 17:40819138-40819160 TCCGGAGGCGGCGGACGCGGCGG - Exonic
1148111254 17:45145711-45145733 CCCAAGGGGGCCGGGCGCGGTGG - Intergenic
1148419322 17:47531870-47531892 CCCAGAAGGGTCCGGGGCGGGGG - Intronic
1148490983 17:48023939-48023961 GCCGGAGCCGGCGGGCGCGGAGG - Intergenic
1148857055 17:50584584-50584606 CCCAGGGGAGCCGGGGGCGGGGG + Intronic
1149694086 17:58602778-58602800 CCCAGAGGGGCCGGGCGTGGTGG + Intronic
1149789368 17:59463873-59463895 CCCAAAGAAGCCGGGCGCGGTGG + Intergenic
1149799756 17:59556637-59556659 CCCAGTTGTGCCGGGCGCGGTGG + Intergenic
1151266913 17:72963455-72963477 CCCACAGTGGCCGGGCGCGGTGG - Intronic
1151484868 17:74392583-74392605 CCCAGAGTGGCCAGGCGCGGTGG + Intergenic
1151790043 17:76299447-76299469 GCAAGAGGGGCCGGGCGCGGTGG + Intronic
1151790575 17:76303169-76303191 GCAAGAGGGGCCGGGCGCGGTGG - Intronic
1151863266 17:76782125-76782147 CCCACAGGGGCCGGGGGCGGGGG - Intergenic
1152337297 17:79706200-79706222 CCCCGAGGGGTGGGGCGCTGCGG - Intergenic
1152357325 17:79813496-79813518 GACAGAGGCGGCGGGGGCGGCGG + Intergenic
1152362041 17:79837248-79837270 CCCAGTGGGGTCCGGGGCGGGGG + Intronic
1152555742 17:81052369-81052391 CCCAGAGGCCACGTGCACGGGGG - Intronic
1152748514 17:82051997-82052019 CCCAGTGGCGGGGGGCGCGGGGG - Exonic
1152929774 17:83103709-83103731 TCCAGAGGGGTGGGGCGCCGAGG - Intergenic
1154381510 18:13854950-13854972 TGCAGAGGGGCCGGGCGCGGTGG - Intergenic
1154481496 18:14830893-14830915 AACAGAGGGGCCGGGCGCGGTGG + Intronic
1155066983 18:22276448-22276470 CCCAGGGACGTGGGGCGGGGAGG + Intergenic
1157233833 18:45944465-45944487 CACAGATGGGCCGGGCGCGGTGG + Intronic
1157697007 18:49730957-49730979 CCCAAAGGCCTCGGGCCCTGAGG - Intergenic
1157867056 18:51196777-51196799 CCGGGAGGCGGCGGCCGCGGCGG - Exonic
1158435949 18:57435680-57435702 CCCGGGGGCGGCGGGGGCGGCGG - Exonic
1158678372 18:59543546-59543568 CCCCGAGAGGCCGGGCGCGGTGG + Intronic
1159618167 18:70606449-70606471 TCCAGAGCGGCCGGGCGCGGTGG + Intergenic
1160689161 19:453042-453064 CCCAGCGACGTCGGGTGCTGTGG + Intronic
1160701588 19:510084-510106 CCCAGAGCAGCCGGGCGCGGTGG + Intronic
1160745375 19:708930-708952 CCGGGCGGCGGCGGGCGCGGGGG - Intergenic
1160955578 19:1690182-1690204 CCCAGTCTCGCCGGGCGCGGTGG - Intergenic
1161022139 19:2015536-2015558 CCCAGGGGCGGCGGCGGCGGCGG + Exonic
1161172784 19:2821358-2821380 ACCAAAGGCGCCGGGCGCAGTGG - Intronic
1161655049 19:5509134-5509156 GCAAGAGGGGTCGGGCACGGTGG + Intergenic
1162434792 19:10651416-10651438 GCCAAAGACGCCGGGCGCGGTGG - Intergenic
1162724585 19:12682291-12682313 CCTAAAGGCGCCGGGCGCGGTGG - Intergenic
1163270118 19:16247978-16248000 GCCACAGGGGACGGGCGCGGTGG + Intergenic
1163562110 19:18025610-18025632 CCCTGAGGTGCCGGGCGTGGTGG - Intergenic
1163604643 19:18267290-18267312 CCCGGAGGCGTGGGACGCGGCGG + Exonic
1164273915 19:23700249-23700271 GGCTGAGACGTCGGGCGCGGTGG + Intergenic
1164278571 19:23747350-23747372 CCCAAAGTGGCCGGGCGCGGTGG + Intronic
1165697466 19:37911784-37911806 CTCAGAGGGGCCAGGCGCGGTGG - Intronic
1166304073 19:41927963-41927985 CCAGGAGGGGGCGGGCGCGGGGG - Intronic
1167266565 19:48485669-48485691 CCCAGAGGCGGCGTCTGCGGTGG + Exonic
1167797488 19:51719373-51719395 ACCCGCGGCGGCGGGCGCGGTGG - Exonic
1168096881 19:54121002-54121024 CCAGGAGGGGTCTGGCGCGGTGG + Intronic
1168556895 19:57351064-57351086 CCAAGAGGCGTCGTGCAGGGAGG - Intergenic
1168694425 19:58396606-58396628 CGCAGAGGCGGCGGGGGCGGCGG - Exonic
926623694 2:15071336-15071358 CACAAAGGGGCCGGGCGCGGTGG + Intergenic
927544317 2:23939820-23939842 CACAAAGGGGCCGGGCGCGGTGG + Intronic
927592325 2:24367106-24367128 CCCAGGGAGGCCGGGCGCGGTGG - Intergenic
927836355 2:26402135-26402157 CCCGGAGGCGGTGAGCGCGGGGG + Exonic
928031590 2:27784268-27784290 CCCTGAGAGGCCGGGCGCGGTGG - Intronic
928331432 2:30360756-30360778 TCCAGATGGGCCGGGCGCGGTGG - Intergenic
932493224 2:72134299-72134321 CCCAGGGGCCTAGGGGGCGGGGG + Intronic
934971894 2:98770573-98770595 CCCCTAGGGGCCGGGCGCGGTGG + Intergenic
937262411 2:120595077-120595099 CCCAGAGGGGCGGGGCGGGGCGG - Intergenic
938063853 2:128270703-128270725 CCCACAGGAGTGGGGAGCGGAGG - Intronic
938302971 2:130229222-130229244 CCCGGAGGCCGCGGGCGCTGCGG + Intergenic
938453696 2:131445000-131445022 CCCGGAGGCCACGGGCGCTGCGG - Intergenic
939313231 2:140511586-140511608 CCTAGAGGGGCTGGGCGCGGTGG - Intronic
944412442 2:199457721-199457743 CCCGGAGGCGGCGGCGGCGGCGG + Exonic
944676030 2:202034545-202034567 CTCTCATGCGTCGGGCGCGGCGG + Intergenic
945254442 2:207791907-207791929 GCAAGAGGGGTTGGGCGCGGTGG + Intergenic
947754318 2:232550790-232550812 CCCAGCGGGGGCGGGCGCGGGGG - Intronic
1168757397 20:326533-326555 CCAAGGGCCGTCGGGCGAGGGGG + Exonic
1170654434 20:18272923-18272945 GCCAGAGGGGACGGGCGCGGTGG + Intergenic
1171133467 20:22676019-22676041 GCCAGACCCGCCGGGCGCGGTGG - Intergenic
1172118520 20:32584895-32584917 CCCGAGGGCGCCGGGCGCGGCGG - Intronic
1172803994 20:37598297-37598319 CGCAGAGGCGGTGGGCGTGGGGG + Intergenic
1172851162 20:37966150-37966172 CCTAGAGGAGCCGGGCGCGGTGG - Intergenic
1173514090 20:43652716-43652738 ACCAGAGTGGCCGGGCGCGGTGG + Intergenic
1173855995 20:46251194-46251216 CCCAGCAGCGTCGGCGGCGGCGG + Exonic
1174386617 20:50191347-50191369 CCCGGAGGAGGCGGGCGCGGGGG - Exonic
1174940277 20:54919201-54919223 CCAGGAGGGGCCGGGCGCGGTGG + Intergenic
1175149863 20:56925247-56925269 CGGAGCGGCGGCGGGCGCGGGGG + Intergenic
1175792277 20:61747152-61747174 CCCACAGGGACCGGGCGCGGTGG + Intronic
1175892973 20:62323436-62323458 CCCGTAGGCGTCGGGCTGGGAGG - Exonic
1176274420 20:64255718-64255740 CGCAGAGGCGGCGGCGGCGGCGG + Intronic
1177483352 21:21722706-21722728 CTTAGAGGGGCCGGGCGCGGTGG - Intergenic
1178314518 21:31557926-31557948 CCTAGAGGCGCCGTGCGCGGCGG + Intronic
1178364650 21:31979402-31979424 CCAATAGGGGCCGGGCGCGGTGG - Intronic
1178581498 21:33842180-33842202 CCAAGAGTGGCCGGGCGCGGTGG - Intronic
1178922503 21:36747843-36747865 CCCCGAGGCCCCGGGCGCGCCGG + Exonic
1179208918 21:39309535-39309557 CCCAGGGAGGCCGGGCGCGGTGG + Intronic
1179544384 21:42104735-42104757 CCCACAGAGGCCGGGCGCGGTGG - Intronic
1180616390 22:17131106-17131128 ACCAAAGGGGCCGGGCGCGGTGG + Intronic
1182545892 22:31076201-31076223 CCCAGAGGAGGCGGCCACGGTGG - Intronic
1182808615 22:33096850-33096872 TCCAGATCCGCCGGGCGCGGTGG - Intergenic
1183194960 22:36347130-36347152 CCCAGAGGCAACGGGCTCTGGGG - Intronic
1183486279 22:38089215-38089237 CCCAGGGGCCTCGGGGGCTGCGG + Exonic
1184370520 22:44079012-44079034 CTCACAGGGGCCGGGCGCGGTGG - Intronic
1184536630 22:45092019-45092041 CCCAGAAGAGGCGGGCGCGGTGG + Intergenic
949571939 3:5301961-5301983 CCCAGAGACGTCAGGGGTGGGGG - Intergenic
949981164 3:9502412-9502434 GGCAGAGGGGCCGGGCGCGGTGG + Intronic
951555058 3:23912829-23912851 GCCACATACGTCGGGCGCGGTGG + Intronic
951652111 3:24962214-24962236 CCCAAAGGGGCCGGGCGAGGTGG - Intergenic
953406205 3:42660997-42661019 CCCAGAGGCGTTGGCTGAGGAGG - Intronic
953761335 3:45689511-45689533 GCCAGAGGCCTGAGGCGCGGCGG + Intronic
954256492 3:49411494-49411516 CCCAGCGGCGCCGGGCAGGGCGG - Intronic
954411528 3:50373363-50373385 CCCAGTGACCTCGGGCGTGGTGG + Intronic
954868998 3:53752683-53752705 TCCAAAGGTGCCGGGCGCGGTGG - Intronic
955587753 3:60499664-60499686 CACAGAGAGGCCGGGCGCGGTGG - Intronic
956028676 3:65012156-65012178 CACAAAGGGGTCGGGTGCGGTGG + Intergenic
956827132 3:73007774-73007796 CCCATAGAGGCCGGGCGCGGTGG - Intronic
963062058 3:141233178-141233200 TCAAAAGGCCTCGGGCGCGGTGG + Intronic
965403892 3:168248068-168248090 CCCAAATGGGCCGGGCGCGGTGG + Intergenic
966183154 3:177204852-177204874 CCAGGAGGCGCCGGGCGCGGTGG + Intergenic
966777078 3:183552429-183552451 CACAGACTGGTCGGGCGCGGTGG + Intronic
966868634 3:184276244-184276266 GGCAGAGGGGTCGGCCGCGGAGG + Intronic
966908893 3:184547008-184547030 ACCAAAGCCGCCGGGCGCGGTGG - Intronic
967521815 3:190440779-190440801 GGCAGAGGGGCCGGGCGCGGTGG + Intronic
969636795 4:8374041-8374063 CCCAGGGGAGTTGGGGGCGGTGG + Intronic
971629260 4:28968531-28968553 CCTGGAAGCGCCGGGCGCGGTGG - Intergenic
971757561 4:30721978-30722000 CCCGGAGGCGGCGGCAGCGGCGG + Exonic
972144368 4:36003223-36003245 CAAAGATCCGTCGGGCGCGGTGG + Intronic
972617714 4:40715983-40716005 CCCATAGGGGCTGGGCGCGGTGG + Intergenic
973292368 4:48483411-48483433 CTCGGCGGCGTCGGGGGCGGCGG - Exonic
974870782 4:67638379-67638401 CACAGAGGCGAAGGGCACGGGGG - Intronic
975167480 4:71193444-71193466 CCCACATGGGCCGGGCGCGGTGG - Intronic
975812391 4:78182588-78182610 CCCAGAGGGGCCAGGCGCAGTGG + Intronic
980619010 4:135272540-135272562 CCCAGAGAGGCCGGGCGCGGTGG - Intergenic
982018557 4:151180691-151180713 CCCATATGTGTCGGGCGCAGTGG - Intronic
984558005 4:181238580-181238602 ACCAGAGGCGCTGGGCGCAGTGG - Intergenic
992039572 5:72816715-72816737 CCCAGACGCCTCGGGCGCTCGGG - Exonic
992080296 5:73230404-73230426 CCCTGAGGCGCTGGGCGCAGCGG - Intergenic
996919004 5:128745451-128745473 TCCTGAGGGGCCGGGCGCGGTGG - Intronic
999758396 5:154682457-154682479 GACAGAGGGGCCGGGCGCGGTGG - Intergenic
1001977048 5:176008664-176008686 CACAGAGGGGCTGGGCGCGGTGG - Intronic
1002612101 5:180426946-180426968 CAAAGAGGAGCCGGGCGCGGTGG - Intergenic
1002666774 5:180831186-180831208 CCCCGAGGCGGCGGCGGCGGCGG - Intergenic
1002895443 6:1377508-1377530 GACAGACCCGTCGGGCGCGGTGG - Intergenic
1003567037 6:7230598-7230620 CGCAGAGGCGCCGGCCGCTGAGG + Exonic
1003671426 6:8163886-8163908 CTCAGAGGGGCCAGGCGCGGTGG - Intergenic
1004554510 6:16682482-16682504 CCCAGAGAGGCCAGGCGCGGTGG - Intronic
1005523778 6:26625552-26625574 CTAAGAGGGGCCGGGCGCGGTGG - Intergenic
1006383863 6:33717932-33717954 CCCAGAGCAGACAGGCGCGGTGG - Intergenic
1010507098 6:76674370-76674392 GTCAGAGTCGCCGGGCGCGGTGG + Intergenic
1011643056 6:89433158-89433180 CCCTGCGGCGGCGGACGCGGCGG + Intronic
1011860376 6:91747683-91747705 CTCAGAGTTGCCGGGCGCGGTGG + Intergenic
1012999459 6:106008083-106008105 CCCAGTGGGGCTGGGCGCGGTGG + Intergenic
1014801012 6:125778000-125778022 CAGAGAGGGGCCGGGCGCGGTGG - Intergenic
1015700525 6:136031450-136031472 CCAGGAGGGGCCGGGCGCGGTGG + Intronic
1019682798 7:2361704-2361726 CTCAGAGAGGCCGGGCGCGGTGG - Intronic
1019742324 7:2680975-2680997 CCCACAGGCGCCGGGCAGGGCGG + Intronic
1020062134 7:5160546-5160568 CCCAGCAGGGCCGGGCGCGGTGG + Intergenic
1020105697 7:5421331-5421353 CCCAGAGTCCTCGGGCGGCGGGG + Exonic
1020166010 7:5808131-5808153 CCCAGCAGGGCCGGGCGCGGTGG - Intergenic
1020727337 7:11832141-11832163 GCCAGAGGCGGCGGCGGCGGCGG - Exonic
1021474372 7:21043964-21043986 ATCAGAGGGGCCGGGCGCGGTGG + Intergenic
1022443126 7:30449903-30449925 GACAGAGGGGTCGGGTGCGGCGG + Intronic
1022999989 7:35798737-35798759 CACAGAGTGGCCGGGCGCGGTGG - Intergenic
1023418131 7:39950795-39950817 AGCAGAGGCGGCGGGGGCGGCGG - Exonic
1026079894 7:67208402-67208424 CCCACAACCATCGGGCGCGGTGG + Intronic
1029896342 7:103989093-103989115 CCCGGCGGCGGCGAGCGCGGAGG + Intronic
1032021873 7:128411187-128411209 TCCAGATGCGCCGGGCGCGGTGG - Intergenic
1032074565 7:128830334-128830356 CCCGGGGGCCGCGGGCGCGGCGG + Intergenic
1033934690 7:146569304-146569326 CACAGAGAGGCCGGGCGCGGCGG - Intronic
1034957725 7:155344940-155344962 CCCTGCGGCGTGGGGCGCGGCGG - Intergenic
1035169540 7:157009946-157009968 CCCAGCGGCGGCGGCGGCGGCGG + Exonic
1035432737 7:158834430-158834452 CCAAGAGGTGCCGGGCGCAGTGG - Intergenic
1036787071 8:11695116-11695138 GCCAGAGGCTGGGGGCGCGGTGG + Intronic
1037769272 8:21789356-21789378 CCCAGCGGCGCAGGGGGCGGGGG - Intronic
1037787742 8:21912515-21912537 GCCAGAGGCGTGGGAGGCGGGGG + Intronic
1042532865 8:69833001-69833023 CCCAGCGGCGGCGGCGGCGGCGG - Exonic
1043428468 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG + Intronic
1043542545 8:81280309-81280331 CCATGAGGCGTGGGGCGCGCCGG + Intergenic
1045582877 8:103499651-103499673 GCCCGAGGTGTCGGGGGCGGGGG - Intergenic
1047413398 8:124642878-124642900 CCCAGAAGAGCCGGGCGCAGTGG - Intronic
1047658023 8:127000102-127000124 CCCAGAGAGGCCAGGCGCGGTGG + Intergenic
1047835153 8:128681356-128681378 CAAAGAACCGTCGGGCGCGGTGG - Intergenic
1048981169 8:139703914-139703936 TCCGGGGGCGGCGGGCGCGGCGG + Intergenic
1049754844 8:144306017-144306039 ACCAGAGGGGCCGGGCGCGGTGG - Intronic
1049769855 8:144374716-144374738 CCCTGAGGCGGCGGGCGGGCGGG + Intronic
1050566426 9:6889073-6889095 CACAGAAGGGCCGGGCGCGGTGG - Intronic
1051282886 9:15460676-15460698 CCCAAAGCAGCCGGGCGCGGTGG - Exonic
1053235321 9:36448715-36448737 CCCAAATGGGCCGGGCGCGGTGG + Intronic
1053697319 9:40650459-40650481 ACCCGAGGCGGCGGGCGGGGGGG + Intergenic
1054308627 9:63449908-63449930 ACCCGAGGCGGCGGGCGGGGGGG + Intergenic
1054489519 9:65762926-65762948 ACCCGAGGCGGCGGGCGGGGGGG - Intergenic
1058578982 9:106434501-106434523 CCCAGAGGGGTGGGGGGAGGGGG + Intergenic
1060389889 9:123268524-123268546 CCCAGCGGCGGCGGCTGCGGCGG + Intronic
1061075737 9:128340515-128340537 CCGAGCGGCGTCAGGCGCGCTGG + Intergenic
1061159931 9:128887927-128887949 TCCAGGGGAGCCGGGCGCGGTGG - Intronic
1061683976 9:132259625-132259647 CGAAGAGGGGCCGGGCGCGGTGG + Intergenic
1062269446 9:135701917-135701939 CCCAGGGGTGTAGGGCCCGGTGG + Intergenic
1062416942 9:136456008-136456030 CACAGAGGCGTCTGGCAAGGTGG - Intronic
1062462146 9:136666453-136666475 CCCAGGGGTGCCGGGCGGGGAGG - Intronic
1062646648 9:137551419-137551441 CCCAGAGGAGCCGCGCCCGGCGG + Exonic
1188386504 X:29566224-29566246 CCCACATGGGCCGGGCGCGGTGG - Intronic
1190542984 X:51496915-51496937 GCCCGAGGCGTCGCGCGCTGCGG - Intergenic
1192479816 X:71475296-71475318 GCTAGAGGCGTCAGGCGCAGTGG + Intronic
1193689967 X:84629748-84629770 CCCAAAGAGGTCAGGCGCGGTGG + Intergenic
1197754470 X:129984228-129984250 CCCAGAAGCGGCGGCGGCGGCGG - Intronic
1199082242 X:143590187-143590209 CCCTGAGGCGGGGGGCGGGGGGG - Intergenic
1200138621 X:153886499-153886521 CCCAGAGGCCTGGGGCCGGGCGG + Intronic
1200328332 X:155265833-155265855 CCCAGAGGGGTGGGGGGAGGGGG + Intergenic