ID: 1043428470

View in Genome Browser
Species Human (GRCh38)
Location 8:80171587-80171609
Sequence GCGGCGGCGCCGCCCGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 290}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428454_1043428470 22 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428469_1043428470 -8 Left 1043428469 8:80171572-80171594 CCAGAGGCGTCGGGCGCGGCGGC 0: 1
1: 0
2: 5
3: 44
4: 342
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428465_1043428470 -5 Left 1043428465 8:80171569-80171591 CCCCCAGAGGCGTCGGGCGCGGC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428463_1043428470 -2 Left 1043428463 8:80171566-80171588 CCACCCCCAGAGGCGTCGGGCGC 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428456_1043428470 10 Left 1043428456 8:80171554-80171576 CCCGCGAAGTCCCCACCCCCAGA 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428452_1043428470 30 Left 1043428452 8:80171534-80171556 CCTCGCCTCCGCCGGCGACTCCC 0: 1
1: 0
2: 4
3: 39
4: 342
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428457_1043428470 9 Left 1043428457 8:80171555-80171577 CCGCGAAGTCCCCACCCCCAGAG 0: 1
1: 0
2: 3
3: 31
4: 316
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428461_1043428470 0 Left 1043428461 8:80171564-80171586 CCCCACCCCCAGAGGCGTCGGGC 0: 1
1: 0
2: 0
3: 18
4: 135
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428467_1043428470 -7 Left 1043428467 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 2
3: 10
4: 153
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428453_1043428470 25 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428462_1043428470 -1 Left 1043428462 8:80171565-80171587 CCCACCCCCAGAGGCGTCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428455_1043428470 19 Left 1043428455 8:80171545-80171567 CCGGCGACTCCCGCGAAGTCCCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290
1043428466_1043428470 -6 Left 1043428466 8:80171570-80171592 CCCCAGAGGCGTCGGGCGCGGCG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG 0: 1
1: 0
2: 3
3: 37
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428470 Original CRISPR GCGGCGGCGCCGCCCGCCCT CGG Intronic
900001028 1:14940-14962 GCAGGGCCGCTGCCCGCCCTGGG - Intergenic
900020743 1:185461-185483 GCAGGGCCGCTGCCCGCCCTGGG - Intergenic
900135705 1:1116103-1116125 GCGGTGGCGCCGCGCCCCCTGGG + Intronic
900204486 1:1426241-1426263 GCGGGGGCCCCGACCACCCTGGG - Exonic
900233474 1:1574704-1574726 GCGGCCTCCCCGCCCACCCTGGG + Exonic
900269351 1:1779002-1779024 GCGGCAGCGCTGCGCTCCCTCGG + Intronic
900349525 1:2228110-2228132 GCGGAGGCGCCTCTCGCCCGCGG - Intergenic
900390266 1:2430795-2430817 GTGGCGGCCCCACCTGCCCTGGG - Intronic
901084777 1:6603618-6603640 GCTCCGGGGCTGCCCGCCCTAGG + Intronic
901088334 1:6625427-6625449 GCGGCGGCGCCAGCCCCTCTGGG - Intronic
901629014 1:10639225-10639247 GCGGCGGCGGCGCCCTCGCGCGG + Exonic
901922900 1:12548876-12548898 GTGGCGGCGGCTCCCGCCCCAGG - Intergenic
902067478 1:13700248-13700270 GCGGCGGCGGCGGCGGCCCTCGG + Intronic
902072101 1:13749186-13749208 GCGCCGGCGCGGCCCGCACGGGG + Intronic
902072116 1:13749229-13749251 TCGGCGGCGCCGCGCGCACCCGG - Intronic
903184711 1:21622535-21622557 GCGGCGGCGCTGCCTGCGATGGG + Intronic
903324778 1:22563593-22563615 GCGGGGGCGCCACGCACCCTCGG - Exonic
903652369 1:24929917-24929939 GCGCCCGCGCCGGCCGCCCCCGG - Intronic
904039438 1:27575658-27575680 CCGGCCGCGCGGCCCGCCCTCGG + Intronic
904143252 1:28369971-28369993 GCGGCGGCCCCGCCCCGCCCTGG - Intronic
904257123 1:29260850-29260872 ACGGCGGCACTGGCCGCCCTGGG + Exonic
905137092 1:35808249-35808271 GCGGCGGCGGCGCCCGGCCCGGG - Exonic
905414325 1:37794181-37794203 GCGGCGCCGCCGCCGGGCCATGG - Exonic
905432049 1:37931606-37931628 GCGGCGGTGCGCCCGGCCCTCGG - Intronic
906520895 1:46466452-46466474 GCGGCCGCATCGCCCGGCCTGGG - Intergenic
911789627 1:101996973-101996995 GCAGCGGCGGCAGCCGCCCTGGG + Exonic
912337542 1:108876899-108876921 CCCGCTGCGCCGCCCGCCATTGG + Exonic
915552312 1:156642288-156642310 GCAGCCCCGCCGCCCGCCGTGGG + Intronic
916694480 1:167221559-167221581 GGGGGGGCGCTGCCCGCCTTGGG + Intronic
921039538 1:211416668-211416690 GCGGCGGCGCCGGGGGCCCCGGG + Intergenic
923055993 1:230426212-230426234 GCGGCGGCGGCGCCTGGTCTCGG - Intergenic
1064354360 10:14604160-14604182 GCGGCGGCCCTGCCCGACCCCGG - Intronic
1065023084 10:21516867-21516889 GCGGCGGCGGCGGCCGCCGCGGG - Exonic
1065188609 10:23191967-23191989 GCGCCGGCTCCTTCCGCCCTGGG - Intergenic
1066406980 10:35127349-35127371 GCGGCTGCCCCGCCAGTCCTTGG - Intronic
1066464510 10:35640798-35640820 GCGGCGGCGCCCCCAGCTCGCGG - Exonic
1070570675 10:77637843-77637865 GAGCCGCCGCCGCCCGCCCGGGG + Intronic
1071309532 10:84329053-84329075 GCGGCGGCGCCCGCGGCCCGAGG - Intronic
1071695383 10:87863931-87863953 GCGGCGGCACCTCCCGCTCCTGG + Exonic
1072757517 10:98030702-98030724 GCGCCGGCGCCCCCCACCCCGGG - Exonic
1073325845 10:102643731-102643753 GCGGCGGGGGCGCCGGGCCTCGG + Intergenic
1077008469 11:369780-369802 GCGGCCGCCGCGCCCGCCCCAGG - Intronic
1077053119 11:576599-576621 GCGGCGGCCGCGCCGGCCCTGGG + Intronic
1078594424 11:12674495-12674517 GCGGCCCCGCCGCCCGCCGCGGG + Intergenic
1078771853 11:14358906-14358928 CCGCCGCTGCCGCCCGCCCTAGG + Exonic
1080689159 11:34541466-34541488 GCGGTGGGGCCTCCAGCCCTAGG + Intergenic
1081873038 11:46391847-46391869 GGGGCCGCGCCGCCCGCCCCGGG + Intergenic
1081969091 11:47186111-47186133 GCGCCGGCGCCGCCTCCCCCGGG + Intronic
1083593692 11:63909290-63909312 GCCGCTGCGCCGCCCCACCTGGG + Exonic
1083999610 11:66289006-66289028 GAGGCGGCGCAGCGGGCCCTCGG - Exonic
1084129039 11:67119350-67119372 GCGGCGGCGGCGGCGGCTCTCGG + Intronic
1084212302 11:67629867-67629889 GCGGCAGCGCAGCTCGCCCTCGG + Exonic
1084517190 11:69643358-69643380 GCGGCGGGGCCGCCCTCCCTCGG - Intronic
1086034895 11:82403997-82404019 CCGGCGGAGCCGCCCGCCCGGGG + Intergenic
1087138111 11:94740504-94740526 CCGCCGCCGCCGCGCGCCCTCGG + Intronic
1089981599 11:122777215-122777237 GCGGCAGCGCCCCCACCCCTGGG + Intronic
1090817786 11:130314446-130314468 GCGGCGGCGGCGGCGGCCCGGGG + Exonic
1091374117 12:15055-15077 GCAGGGCCGCTGCCCGCCCTGGG - Intergenic
1091778653 12:3200418-3200440 GCGGAGCTGCCGCCGGCCCTGGG - Intronic
1091866128 12:3838951-3838973 GGGGCGGCGACCCCCGGCCTGGG + Intronic
1094564935 12:31590848-31590870 GCGGCGGCGGCGGCGGCCCCTGG - Exonic
1094807622 12:34107849-34107871 GCAGGGGCGCCGCCCTCCCGCGG + Intergenic
1095446351 12:42286877-42286899 GCGGGGGAGCCGCCGGCCCTCGG + Intronic
1095476235 12:42589776-42589798 GCCGCCGCGCACCCCGCCCTCGG + Intronic
1096106333 12:48998617-48998639 GCCGCCGCCCCGCCGGCCCTGGG - Exonic
1097195646 12:57241229-57241251 ACGTCGGCGCTACCCGCCCTAGG - Intergenic
1097891452 12:64781122-64781144 GCGGCGCCGCCGGCGGCCCTCGG - Intergenic
1098426092 12:70366644-70366666 GCGGCGGCTCCTCCCGCCCGAGG + Exonic
1101865214 12:108515413-108515435 GCGACGGGGCCGCGAGCCCTGGG + Intronic
1102136865 12:110582940-110582962 CCGCCGCCGCCGCCGGCCCTGGG + Exonic
1102197085 12:111033810-111033832 GCGGCGGCGCCGGCGCCTCTCGG + Intergenic
1102197410 12:111034855-111034877 GCGGCGGCGGCGGCGGCCCCCGG - Intronic
1102289301 12:111685866-111685888 GTGGCGGCGCTGCCGGCCCCGGG - Exonic
1103085697 12:118060900-118060922 GCGGCGGGGGCGTCCGGCCTGGG - Intronic
1103120040 12:118372669-118372691 GCGGCGGCGGCGCCGGGCCCGGG - Exonic
1103363940 12:120369130-120369152 GCGGCGGCGGCGGCGGCGCTCGG + Exonic
1103432920 12:120903772-120903794 GCGCCGGCGCGGCCCGCCGAGGG - Intronic
1103527552 12:121578490-121578512 GCGGCGCTCCCGCCCTCCCTCGG + Intronic
1104376285 12:128267423-128267445 ACAGCGGCGCCGCCGGCCCGGGG - Exonic
1104842206 12:131830550-131830572 GCGGGGAAGCCGCCCGCCCCTGG - Intronic
1104857621 12:131909405-131909427 CCGGCGGCGCCGCCCTCCCTGGG - Intronic
1104946141 12:132415654-132415676 GCGGCAGCTCCGCCGGCCCCAGG - Intergenic
1105011856 12:132761623-132761645 GCGGGGGCGGCGGCCGCGCTTGG + Exonic
1105389212 13:19959201-19959223 GCGGGGGTGCCGGCCGCCCGGGG + Intronic
1105512124 13:21060604-21060626 GCGGCCGCGCCGCCGGCTCACGG - Intronic
1106087702 13:26557966-26557988 GCGGCGCCGCAGCCCGCAGTGGG - Intronic
1108518257 13:51222508-51222530 TCGCCGCCGCCGCCCGCCTTTGG - Exonic
1109547058 13:63843969-63843991 GCGGGGGTGCCTCCCGCCCTGGG - Intergenic
1112344366 13:98577320-98577342 CCGGCCCCGCCGCCCGCCCGCGG - Intronic
1112652737 13:101416405-101416427 CCCGCGTCCCCGCCCGCCCTGGG - Intronic
1112693056 13:101917174-101917196 CCGCCGGCGCCGCCCGCTCTCGG + Intronic
1113378409 13:109783958-109783980 GCGGCGGCGGCGGCGGCCCTGGG + Exonic
1113398858 13:109973448-109973470 GCTGCAGCGCCCCCCGCCCCGGG + Intergenic
1113541971 13:111115815-111115837 GCGGCGGCGCGGCCGGCGCCAGG + Intronic
1114270669 14:21098315-21098337 GCTCCGCCGCCGCCCGCCCGGGG - Exonic
1115474667 14:33801105-33801127 ACTGAGGCGCCGCCCGTCCTGGG + Exonic
1115816750 14:37172045-37172067 GCGTCCGCGCCGGCCGCTCTCGG - Intronic
1117377403 14:55129170-55129192 GCAGGGGCGCCGCCCCGCCTCGG + Exonic
1117647368 14:57866008-57866030 GCGGCGGAGCGGCCCCCACTCGG + Intronic
1122162332 14:99793428-99793450 GCGGCGGCGCGGCCGGGCCGGGG + Exonic
1122209444 14:100165583-100165605 GCGGGGGCACCGCCCGTCCGCGG - Intergenic
1122623210 14:103071325-103071347 CGGGCAGCGCCGCCAGCCCTGGG - Intergenic
1122993308 14:105249006-105249028 GCGCCCGCGCCGCCCACACTCGG + Exonic
1124014286 15:25862941-25862963 CCGCCGTCGCCGCTCGCCCTTGG + Exonic
1124453625 15:29821797-29821819 GGGGCGGCGCGGGCCGCACTGGG - Intronic
1124629527 15:31328477-31328499 GCGGGGGCGCGCCCGGCCCTAGG + Intronic
1124960535 15:34389983-34390005 GGGGAGGGGCCGCCCGCTCTGGG + Intronic
1124977164 15:34536204-34536226 GGGGAGGGGCCGCCCGCTCTGGG + Intronic
1127995566 15:64151683-64151705 GGGGCGGAGCCGGCCGCCCCGGG + Intergenic
1129322313 15:74782144-74782166 GCGGCGGCGGCGGCCAACCTCGG - Exonic
1129541142 15:76347467-76347489 GCGGGGGCGCCGATCGCACTTGG + Intergenic
1130224255 15:82045721-82045743 GCCGCGCCCCCGCCGGCCCTCGG + Exonic
1131827044 15:96330480-96330502 CCGGCGACGCCGCTCGCGCTAGG + Intronic
1131979321 15:97979924-97979946 GCGGAGGCCCAGCCTGCCCTGGG + Intergenic
1132365122 15:101251557-101251579 GCGGCGGCGCTGCCCGGGCCGGG - Exonic
1132452481 15:101976000-101976022 GCAGGGCCGCTGCCCGCCCTGGG + Intergenic
1132688861 16:1173380-1173402 GCGGCTGCGCCTCCAGGCCTCGG + Intronic
1132831305 16:1929712-1929734 GCCTCGGCCACGCCCGCCCTTGG - Intergenic
1133156558 16:3880439-3880461 GCGGCGGCGGCGACCCCGCTCGG - Exonic
1134069905 16:11254700-11254722 GGCGAGGCGCCTCCCGCCCTCGG - Exonic
1135429926 16:22374409-22374431 GCGGCGGCGCGTCCCGCCCGAGG - Exonic
1135821882 16:25692371-25692393 GCGGCGGCGGCGGCAGCCCCCGG - Exonic
1136625398 16:31459081-31459103 GCGGTGGTGCGGCCCGGCCTTGG - Exonic
1137454789 16:48609999-48610021 GCGTCGCCGCCGCCGGCCCCCGG - Exonic
1137683216 16:50368812-50368834 GAAGCGGCGCCGCACGGCCTGGG - Intronic
1139403009 16:66696861-66696883 GCGGCGGCGCCGCGGGCCTCGGG + Intergenic
1139534609 16:67563344-67563366 GCGGCGGCGACGCGCGGACTGGG - Intronic
1139615442 16:68085748-68085770 GCGCCGGCGCCGCCGCCCCCGGG + Exonic
1139719825 16:68843556-68843578 GCGGCGGCGGCGCCCTGCCGAGG + Intergenic
1139917837 16:70439127-70439149 GCGGCGGCGGCGGCGGCGCTCGG - Intronic
1141418896 16:83899104-83899126 GCGGCGGCGGCGCTCCCCCTCGG + Exonic
1142336139 16:89490501-89490523 GCGGCGGCGCCTCCCCGGCTGGG + Exonic
1143503594 17:7352203-7352225 CCGGCCGCGCCGCCTTCCCTGGG - Exonic
1143527258 17:7479685-7479707 GCGGCGGCGGCGGCGGCGCTGGG - Intronic
1143676390 17:8436093-8436115 GCGGCGCCGAGGCCTGCCCTTGG + Intronic
1144756131 17:17681685-17681707 GCGGCGGCCCGGCCGGCCCGCGG - Exonic
1145050323 17:19654577-19654599 TGGCCGGCGCCGCCAGCCCTGGG - Intronic
1146183185 17:30709827-30709849 GCGGCTTCGCCCCTCGCCCTGGG - Intergenic
1146723941 17:35142326-35142348 GCGGCGACCCCGCCCGACCACGG - Intergenic
1147429635 17:40363469-40363491 GCGGCGGCGCAGTGCGCCCCCGG - Exonic
1147612876 17:41811984-41812006 GCGGGCGCGCCGCCCGCCCGGGG - Exonic
1148081480 17:44969484-44969506 GCGGTGGAGCAGCCCGACCTGGG - Intergenic
1148108616 17:45132368-45132390 GCGTTGCCGCCGCCCGCCCGAGG - Exonic
1148151096 17:45396775-45396797 GCGGCAGCCGCGCCCGCCCTGGG - Exonic
1148323784 17:46771919-46771941 GCGGCGGCGCGGCGGGCCCGAGG - Intronic
1148388550 17:47253873-47253895 GCCGCGGCCCCGGCCGCTCTGGG + Intergenic
1149461488 17:56833524-56833546 GCGGCTGCCCCGCTCGCCCTCGG + Intronic
1152356887 17:79811831-79811853 GCTGCGGCGGCGGCAGCCCTTGG + Intergenic
1152730426 17:81967204-81967226 GCGACGGCACCGCCTGGCCTCGG - Intergenic
1152834485 17:82520269-82520291 GCGGCGGCGCCCCGCGCCTCTGG - Exonic
1155199357 18:23503601-23503623 GCGGGCGCGGCGCCCGCCATGGG + Exonic
1157354066 18:46917352-46917374 GCGGCGGCGGCGCCCGCGGGTGG - Intronic
1157842136 18:50968277-50968299 GCGGCGGCGCCGGGCGGCCGAGG - Intronic
1160538965 18:79610260-79610282 GCGGGGGCTCAGCCTGCCCTGGG - Intergenic
1160548859 18:79680286-79680308 TCCCCGGAGCCGCCCGCCCTCGG - Intronic
1160662014 19:305715-305737 GCGGCGGCGCGCCCTGCCCCGGG - Exonic
1160767029 19:813253-813275 GCGGCGGCCCCGCGCGCGGTGGG + Exonic
1161047805 19:2145604-2145626 GGAGCGGCGACGCCAGCCCTGGG - Intronic
1161318658 19:3631165-3631187 GACGCGGTGCCGCCCGCCCGGGG + Exonic
1161388108 19:4007678-4007700 GCGGCGGCCCCGCCCGCGAGTGG + Exonic
1161412417 19:4123883-4123905 GCGCCGCCGCCGCCGGCCCGCGG - Exonic
1161412461 19:4123999-4124021 CCCGCAGCGCCGCCCGCCCTCGG - Exonic
1162959495 19:14117630-14117652 GCGGCGGCGGCGGCGGCCCTCGG + Exonic
1162975609 19:14205947-14205969 GCGGCTTCGCCCCTCGCCCTGGG + Intronic
1163358334 19:16829545-16829567 GTGGCGTCCCCGCCCTCCCTCGG + Intronic
1163488956 19:17605918-17605940 GCGTAGGCGCAGCCCACCCTTGG + Exonic
1163679321 19:18671534-18671556 ACAGCAGCGCCCCCCGCCCTGGG - Exonic
1163804119 19:19385889-19385911 GCGGCGGCTCCTCCCGCCCAGGG + Exonic
1165349518 19:35268503-35268525 GCGGCGGCGGCGCGAGCCCCGGG - Intergenic
1167304014 19:48696551-48696573 GGGACGGAGCCGCCCTCCCTGGG - Intronic
1167649080 19:50719727-50719749 GCGGCGGCGGCGGCGGCCCGAGG - Intergenic
1168295126 19:55374465-55374487 GGGGCGGGGCCGCCTGGCCTTGG - Intergenic
1168495035 19:56840649-56840671 CCGGCGGCGCCACCAGCCCAGGG + Exonic
925024651 2:598236-598258 GCCACCGCACCGCCCGCCCTCGG + Intergenic
926217206 2:10912896-10912918 GCAGCGGCGCCAGCGGCCCTCGG - Exonic
927168828 2:20351229-20351251 GCGCCCGCGCCGCCCACCGTGGG + Intronic
927312600 2:21647973-21647995 GCTACAGCGCCCCCCGCCCTGGG - Intergenic
927881460 2:26692717-26692739 GCGGCGGCGGCGGCGGCCCCGGG + Intronic
931614735 2:64144367-64144389 GCGGCGGCGGCGCCCCCCGACGG + Exonic
936568693 2:113598474-113598496 GCAGGGCCGCTGCCCGCCCTGGG + Intergenic
944743726 2:202635598-202635620 GCGGCGGCGGCGGCGGCCGTGGG - Exonic
945234948 2:207625227-207625249 GCGGCGCCTCAGCCCGGCCTGGG - Exonic
946248564 2:218400226-218400248 GCGGCGGCGGCGGCTCCCCTGGG - Intronic
946340117 2:219061040-219061062 GTGCCGGGGCCGCCCGCCCGAGG - Intergenic
946692288 2:222319070-222319092 GCGGCGGCGGCGGCGGCCCGAGG - Intergenic
946908973 2:224442326-224442348 TCGGCCGCGCCGCCGGCCCGGGG - Intergenic
947592938 2:231395593-231395615 GCGGCGGCGGGGCGGGCCCTGGG + Exonic
948140557 2:235669782-235669804 CGGGCGCCGCCGCCTGCCCTGGG + Intronic
948473718 2:238203402-238203424 GCTGAGGCGGCGCCCGCGCTGGG - Intronic
949032494 2:241803677-241803699 GCTGCGGCGCCGGCTGCGCTGGG + Exonic
1168965410 20:1895287-1895309 GCGGCGGCGGCGGCCGCTCCAGG + Intronic
1169214724 20:3786502-3786524 GCGGCGGCGGCGCCGGGCCCCGG - Exonic
1172277232 20:33686300-33686322 GCGGCGGCGGCGCGGGCCCATGG + Exonic
1172409340 20:34710112-34710134 CCAGCAGCGCCGCCCGCGCTGGG - Exonic
1172919958 20:38473011-38473033 GCGCCGCCGCCGGCCGTCCTCGG - Exonic
1173576574 20:44116073-44116095 GCTGCGGCGGCCCGCGCCCTCGG + Exonic
1175959177 20:62626400-62626422 GTGGGGGCGCCTCCTGCCCTGGG - Intergenic
1175997244 20:62817327-62817349 GCGGCGGCGCCGGCCGACCCGGG - Intronic
1176125276 20:63472273-63472295 GCGCCCGCGCCGCCCGCGCGAGG + Exonic
1176171512 20:63698396-63698418 AAGGCCGCGCGGCCCGCCCTTGG - Exonic
1176547805 21:8209013-8209035 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1176555697 21:8253215-8253237 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1176566748 21:8392050-8392072 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1176574631 21:8436247-8436269 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1176611244 21:8987539-8987561 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1178544117 21:33479423-33479445 GCGGCCGCGACGCCCTCCCGAGG - Intronic
1178561626 21:33643265-33643287 GCGGCCCCGCGGCGCGCCCTGGG - Intronic
1178673756 21:34614446-34614468 GCGGCGGCGCTGCCCCACCTTGG + Intronic
1178981195 21:37267010-37267032 GCGGCGGCGGCGCCTGCCCTGGG + Intronic
1180177649 21:46098248-46098270 GCGGCGGCGGCTCCGTCCCTCGG + Intronic
1180962035 22:19766499-19766521 CCGCCGGCGCCGCCGGCCCCGGG - Exonic
1181768814 22:25111402-25111424 GCGGTGGCGGCGGCCGCCCAGGG - Intronic
1182122552 22:27797233-27797255 AAGGCGCCCCCGCCCGCCCTCGG - Exonic
1182236999 22:28883798-28883820 GCGGCGGCGGCGGCGGCCCGTGG - Exonic
1182903882 22:33920545-33920567 GGGCCTGCGCCGCCCGCCCGCGG + Intronic
1182904053 22:33921065-33921087 GCGCCGGCCCCGCCCCCGCTCGG - Intronic
1183368586 22:37419896-37419918 GCGGCGGGGCGGGCCGCGCTGGG - Intronic
1183386743 22:37519386-37519408 GCGGCGGCTCCGCCGGCGCAGGG + Exonic
1183418649 22:37697429-37697451 GCATCGGCCCCGCCCGTCCTGGG - Intronic
1184413105 22:44337187-44337209 GCGGCGGCATCACCCGGCCTTGG + Intergenic
1184596222 22:45515828-45515850 GAGGCGGCGCTGCCTGCCCAGGG + Intronic
1203252679 22_KI270733v1_random:125298-125320 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1203260735 22_KI270733v1_random:170384-170406 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
951543635 3:23806121-23806143 CCGGCCGCGCCGCCGGGCCTCGG + Intronic
952382922 3:32818306-32818328 GCCGCGCCGCCGCCCGCCGCCGG - Exonic
954733519 3:52685715-52685737 GGAGCGGCCCCACCCGCCCTGGG + Intronic
954735814 3:52705847-52705869 GCGGGGGCGCCGGCGGCCGTTGG + Exonic
956677937 3:71753429-71753451 CCGGCGGCGGCGCCCGCGCTGGG - Intronic
961574302 3:127822532-127822554 GCAGCGCCGCTCCCCGCCCTGGG - Exonic
961827570 3:129606864-129606886 GCCCCGGCCCCGCCCGCCCCCGG + Intergenic
964757383 3:160100791-160100813 GAAGCGGCGCCGCACGGCCTCGG + Intergenic
966808701 3:183825405-183825427 GAGGCGGCGCCGCCCGTGCCCGG + Exonic
968178155 3:196568946-196568968 GCGGCGGCAGCGGCGGCCCTAGG + Exonic
968698067 4:2042281-2042303 GCGCCCGCCCCGCCCGCCCCGGG - Intronic
968915093 4:3493833-3493855 GCGGCAGGGCCTCCAGCCCTTGG - Exonic
969245581 4:5930641-5930663 TCTGGGGCCCCGCCCGCCCTGGG + Intronic
969330403 4:6471193-6471215 GCGGCCGGGCCGCCAGCCCGTGG + Intronic
969559659 4:7939273-7939295 GCGGCGGAGCCTCCCACTCTTGG + Exonic
973613540 4:52658846-52658868 GCTGCTGCGCCCCCCGCCCTCGG - Intronic
976431244 4:84966010-84966032 GCGGCGGCGGCTCCCGGCCAAGG + Intronic
978532582 4:109729983-109730005 GCGACGGCGCTGCCTGCCCGAGG - Exonic
981475147 4:145180295-145180317 GGGGCGGCGACCCCCGGCCTGGG - Intergenic
984462997 4:180059175-180059197 GCGGCGGCTCCGCTCGCCCCGGG + Intergenic
984928378 4:184826084-184826106 GCGCCGGCCCCGCCCTCCCGCGG + Intronic
984973437 4:185209962-185209984 GCGGCGGCGCCGGGGGCCCCGGG + Intronic
988949351 5:36241701-36241723 GCGGCGGGGCCTCCCGCACCCGG + Exonic
989011538 5:36877208-36877230 GCGGCGGCGGCGCCGGCGCCAGG + Intronic
990381856 5:55227103-55227125 GGGGCGGCGCGGCCGGCCGTCGG - Exonic
990955051 5:61332408-61332430 GCCGCCGCGCCACCCGCCCGCGG - Exonic
992105502 5:73447152-73447174 GTGGCGGCGCCGCCAGCTCCCGG - Exonic
994197562 5:96936391-96936413 GCGCCGCCGCCGCTCGCCCGGGG + Intronic
995650362 5:114362175-114362197 GCGGCGGCGGCGGCTGCTCTGGG - Exonic
999300006 5:150485521-150485543 GCGGCGGCTCCGAGGGCCCTGGG - Intergenic
999374928 5:151080582-151080604 GCCGCAGCGCCGCCCGCACCCGG + Intronic
1002055706 5:176596960-176596982 GCGGCGGCGCGGGCGCCCCTTGG + Exonic
1002291750 5:178205057-178205079 GCGGCGCCCCCGTCCGCCCGCGG - Intronic
1003551827 6:7107663-7107685 GCGGCGGCGGCGCTCGGACTGGG - Intronic
1003551829 6:7107669-7107691 GCGGCGGCGGCGGCGGCGCTCGG - Intronic
1003942682 6:11044388-11044410 GCGGCGGCGGCGCGAGCCCGAGG - Intergenic
1004193965 6:13487672-13487694 GCTGCAGCGCCGCGCGCCATTGG + Intergenic
1004562086 6:16760888-16760910 GCGGCGGCGCCCCGCTCCCCCGG - Intronic
1004614902 6:17280884-17280906 GCGGCGGCGCCCGGCGCCCCAGG + Intergenic
1005958181 6:30679152-30679174 GCGGAGGCTCCGCCGGCCCGAGG - Intronic
1006393381 6:33771929-33771951 GAGGCGGGCCCGCCCGCCCTGGG + Exonic
1006428745 6:33982431-33982453 GCGGGGGCGCTGGCAGCCCTGGG - Intergenic
1011075180 6:83431052-83431074 GTGGCGGCGGCGGCCGCACTGGG + Exonic
1011416253 6:87122771-87122793 GCGGCGGCGGCGGCGGGCCTGGG + Intergenic
1012550944 6:100464524-100464546 GCCGCGGCGCCTCCCACCCCCGG - Intronic
1014820777 6:125986512-125986534 GCGCCTGCGCGGCCCGCGCTAGG - Exonic
1015149270 6:130019993-130020015 GCGGCGGCGGCGGCCGCGCCGGG + Intronic
1015935598 6:138404057-138404079 GCCGCGGCCCCGCCCGCGCTGGG - Intronic
1017842269 6:158231986-158232008 GCCGCCGCGCCGCCCGCCACCGG - Intergenic
1017962433 6:159233619-159233641 GGGGCGGGGCCGCCCGGCCTGGG - Exonic
1021969380 7:25951420-25951442 GCGGGGGCGCGGCCGGCGCTGGG + Intergenic
1022310901 7:29194885-29194907 GCGGCGGCGGCGTCCGCACCGGG + Exonic
1022715087 7:32891669-32891691 GCGGCGGCGCCAGCCTTCCTCGG - Exonic
1023999260 7:45180200-45180222 GCTGGGGCACCGCCCTCCCTGGG - Intronic
1025098451 7:56115931-56115953 GGCGCGGCGCTGCTCGCCCTGGG - Intronic
1027232662 7:76281736-76281758 GCCGCGGCGCCCCCGGCCCCGGG + Exonic
1028985658 7:97006519-97006541 CAGGCGGCCCCGCGCGCCCTTGG + Intronic
1029456509 7:100674824-100674846 CCGGCGGTGCCGCCAGGCCTGGG + Intronic
1029640541 7:101816768-101816790 GCGGCGGCGCGGCCCGGCTCCGG + Intronic
1032021659 7:128409984-128410006 CCGGCGGCCCCGCCCCTCCTCGG - Exonic
1032117018 7:129126372-129126394 CCCGCAGCGCCGCCCGCCCTCGG + Intergenic
1032306113 7:130733792-130733814 GGCGCGGCGCCGCCCGCGCCGGG + Exonic
1033159246 7:138981692-138981714 GGGGCGGCACCGCCCGGCCCAGG - Intergenic
1033361259 7:140640514-140640536 GCGGCGGCTCCGCGGGCTCTGGG + Exonic
1034441111 7:151086554-151086576 GCGGCGGCGCCTCCTGGCCTCGG + Intronic
1034441197 7:151086799-151086821 GCGGCAGCGCCGCCGCCCCCCGG - Exonic
1034957550 7:155344437-155344459 GCTGCGGGGCCTCCCGACCTGGG + Intergenic
1034977798 7:155458244-155458266 GCGGCCGCCGCGCACGCCCTCGG + Exonic
1035187738 7:157139236-157139258 GCGGCGGCGCTGCCCGCACATGG + Exonic
1035664820 8:1373242-1373264 GCGGCGGCGCCTCCCCCCGAGGG - Intergenic
1036910777 8:12755423-12755445 GCGGCGGCGCAGCCCTCCGCGGG - Exonic
1037390514 8:18387245-18387267 GCGGCGGCGCCGCCAGCGGGAGG - Intergenic
1039618377 8:38974734-38974756 GCCGCGGGGGCGCGCGCCCTCGG + Intronic
1039621085 8:38997270-38997292 GCGGCCGCGCCCCCCGACCCCGG - Intronic
1040548373 8:48419761-48419783 GGGGCAACGCCGCCCGCCATGGG + Intergenic
1041919803 8:63168842-63168864 GCGGCGGCGGCGGCGGCTCTCGG + Exonic
1042933443 8:74035365-74035387 GCGGCGTGGCTGCCTGCCCTGGG - Intergenic
1043388254 8:79768315-79768337 GCGGCGGCGGCGGCGGCGCTGGG + Intergenic
1043428470 8:80171587-80171609 GCGGCGGCGCCGCCCGCCCTCGG + Intronic
1045269471 8:100649676-100649698 GAGGCGGCGCGGCCCGGCCCCGG - Intronic
1045743350 8:105387547-105387569 CAGCCGGCCCCGCCCGCCCTAGG - Intronic
1046770370 8:118111699-118111721 GCGGCGGCGGCGGCGGCGCTGGG + Exonic
1049395211 8:142397078-142397100 GAGGCAGCTCCGCCTGCCCTGGG + Intronic
1049395234 8:142397172-142397194 GAGGCAGCTCCGCCTGCCCTGGG + Intronic
1049595879 8:143483143-143483165 GCTGCGGCGCCGCCTCCCCCCGG - Intronic
1049896208 9:113778-113800 GCGGCGCCGTCGCGCGCACTCGG + Intergenic
1052903983 9:33817722-33817744 GCGGCGGCGGCGCCGGGCCCGGG - Exonic
1056167845 9:83956310-83956332 GCGGCCTCGTCGGCCGCCCTGGG + Exonic
1057080741 9:92172749-92172771 GGAGCGGCGCTGCTCGCCCTTGG - Intergenic
1057606230 9:96499457-96499479 GGGCCGGTGCCGCCCGACCTTGG + Intronic
1060700920 9:125747960-125747982 CCGGCGGCGCGGCCCGCACGGGG - Intronic
1061134254 9:128724145-128724167 GCGGCGGCGTTCCCCTCCCTCGG - Intergenic
1061975852 9:134067790-134067812 GCGGCGGCGGCGGCGGCCCCGGG + Intronic
1062315986 9:135967168-135967190 GCGGCGGTGGCGTCAGCCCTCGG + Intergenic
1062533050 9:137010158-137010180 GCGGCGGCCCCGCCCACCCAGGG + Intronic
1062574611 9:137200371-137200393 CCGCCCGCGCCGCCCGCCCCGGG - Exonic
1062696134 9:137877437-137877459 CCGGAGGCGCCACCAGCCCTGGG - Intergenic
1062718637 9:138023478-138023500 GTGGTGCCGCCGGCCGCCCTCGG - Exonic
1203469082 Un_GL000220v1:108449-108471 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1203476903 Un_GL000220v1:152421-152443 GCGGGCGCGCCGGCCGGCCTCGG + Intergenic
1189010723 X:37043564-37043586 GCGCCCGCGCTGCCCGCCCTGGG - Intergenic
1189035680 X:37491991-37492013 GCGCCCGCGCTGCCCGCCCTGGG + Intronic
1189037170 X:37505304-37505326 GCGCCCGCACTGCCCGCCCTGGG + Intronic
1192584091 X:72306538-72306560 GCGGCGGAGCCCCCAGCCCCTGG + Intronic
1194977588 X:100409703-100409725 GCGGCGGCGGCGGCGGACCTTGG - Exonic
1200128958 X:153830775-153830797 GCGGCGGCGGCCCCCGCCCGCGG + Intergenic
1200173627 X:154097227-154097249 GCGGCGCCGTCGCGCGCCCGCGG - Intronic
1200401978 X:156025108-156025130 GCAGGGCCGCTGCCCGCCCTGGG + Intergenic