ID: 1043428471

View in Genome Browser
Species Human (GRCh38)
Location 8:80171592-80171614
Sequence GGCGCCGCCCGCCCTCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 335}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043428455_1043428471 24 Left 1043428455 8:80171545-80171567 CCGGCGACTCCCGCGAAGTCCCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428463_1043428471 3 Left 1043428463 8:80171566-80171588 CCACCCCCAGAGGCGTCGGGCGC 0: 1
1: 0
2: 1
3: 6
4: 81
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428469_1043428471 -3 Left 1043428469 8:80171572-80171594 CCAGAGGCGTCGGGCGCGGCGGC 0: 1
1: 0
2: 5
3: 44
4: 342
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428467_1043428471 -2 Left 1043428467 8:80171571-80171593 CCCAGAGGCGTCGGGCGCGGCGG 0: 1
1: 0
2: 2
3: 10
4: 153
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428465_1043428471 0 Left 1043428465 8:80171569-80171591 CCCCCAGAGGCGTCGGGCGCGGC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428456_1043428471 15 Left 1043428456 8:80171554-80171576 CCCGCGAAGTCCCCACCCCCAGA 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428462_1043428471 4 Left 1043428462 8:80171565-80171587 CCCACCCCCAGAGGCGTCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428457_1043428471 14 Left 1043428457 8:80171555-80171577 CCGCGAAGTCCCCACCCCCAGAG 0: 1
1: 0
2: 3
3: 31
4: 316
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428466_1043428471 -1 Left 1043428466 8:80171570-80171592 CCCCAGAGGCGTCGGGCGCGGCG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428453_1043428471 30 Left 1043428453 8:80171539-80171561 CCTCCGCCGGCGACTCCCGCGAA 0: 1
1: 0
2: 2
3: 9
4: 45
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428461_1043428471 5 Left 1043428461 8:80171564-80171586 CCCCACCCCCAGAGGCGTCGGGC 0: 1
1: 0
2: 0
3: 18
4: 135
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335
1043428454_1043428471 27 Left 1043428454 8:80171542-80171564 CCGCCGGCGACTCCCGCGAAGTC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG 0: 1
1: 0
2: 4
3: 51
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043428471 Original CRISPR GGCGCCGCCCGCCCTCGGCC TGG Intronic
900736652 1:4303417-4303439 GGAGACGCCAGCCCCCGGCCAGG - Intergenic
901250180 1:7771723-7771745 GGGAGCGCCCGCTCTCGGCCCGG + Intronic
901629015 1:10639230-10639252 GGCGGCGCCCTCGCGCGGCCCGG + Exonic
902072104 1:13749191-13749213 GGCGCGGCCCGCACGGGGCCGGG + Intronic
902259653 1:15215123-15215145 TGCGCTGACCGCCATCGGCCTGG + Exonic
902771284 1:18646899-18646921 GGAGCGGCCCGCCCGCGCCCGGG + Intronic
903986813 1:27234770-27234792 GGCGCTGTCCGGCCCCGGCCAGG + Exonic
904664402 1:32108649-32108671 GGCGCAAGCTGCCCTCGGCCTGG - Intronic
904773319 1:32893107-32893129 AGCGCGGGCCGCCCTGGGCCCGG + Intronic
904822627 1:33255883-33255905 GGCACCGCGCGGGCTCGGCCTGG + Intergenic
905107758 1:35574250-35574272 GGCACCGCCCGCCCGCGCCCTGG + Exonic
905422826 1:37859888-37859910 TGCGCTGACCGCCCTCGCCCTGG + Intergenic
905548569 1:38818370-38818392 GGAGCCCCCAGCGCTCGGCCCGG - Intergenic
905789911 1:40784256-40784278 GGCGCGCCCCTCCCTGGGCCGGG + Exonic
905803721 1:40861740-40861762 GCCGCCGCCCGCGCACGCCCTGG - Exonic
907278141 1:53328124-53328146 GGCGGCGGCCGCCCAGGGCCGGG - Intergenic
908703938 1:66930438-66930460 GGCGCCCCCGGCCCTGGGCCGGG + Intronic
909635392 1:77811837-77811859 GGCGCCATCCTCCCCCGGCCTGG + Intronic
910435534 1:87201913-87201935 GGCGCCGCTTGTCCTCTGCCTGG - Intergenic
915835614 1:159172807-159172829 AGCCCCTCCCGCCCTGGGCCGGG + Intronic
920120238 1:203650641-203650663 CTCCCCGCCCGCCCTCGCCCCGG - Intronic
920171221 1:204073531-204073553 CACGCCCCCCGCCGTCGGCCGGG - Intronic
922124866 1:222712373-222712395 GGCGCCATCCTCCCCCGGCCTGG + Exonic
922762229 1:228140329-228140351 GGCTGCGGCCGCCCTGGGCCGGG + Exonic
922819032 1:228471290-228471312 GGCGCCGCATGCCCTGAGCCTGG + Intergenic
922937204 1:229431968-229431990 AGCCCCGCTCGCCCTCGCCCCGG - Intronic
923008048 1:230067518-230067540 CGCGTCGCCCGCCCTCGTCCCGG + Intronic
923171591 1:231422034-231422056 GGCACCCCACGCCCTCGGCCCGG + Exonic
923506450 1:234609755-234609777 CGCGCCGCCCGCCCGTGCCCGGG - Intergenic
923684153 1:236142422-236142444 GGCCCCGCGCGCCCCCGCCCCGG - Intergenic
924362342 1:243254917-243254939 GGCGCCGCCCGCCGCGGGGCGGG - Intronic
1065000692 10:21335213-21335235 GGACCCGCCCTCCCTTGGCCTGG - Intergenic
1065636916 10:27743186-27743208 GGCCCTGCCCGCCTGCGGCCCGG - Intronic
1066429292 10:35336722-35336744 GGCGCCGCCCGCCATGGCCGCGG + Intronic
1067462122 10:46465793-46465815 CGCGCTGCCTGCCCTTGGCCCGG - Exonic
1067474420 10:46556613-46556635 GCCGCCCGCCGCCGTCGGCCCGG + Intergenic
1067625073 10:47918805-47918827 CGCGCTGCCTGCCCTTGGCCCGG + Intergenic
1069521387 10:69124304-69124326 CTCGCCTCCCGCCCTCGTCCCGG + Intronic
1070162590 10:73874723-73874745 GGAGCCGCCCTCGCTGGGCCAGG + Intergenic
1070333043 10:75431533-75431555 GCCGCCGCCGCCCCTCGGCCCGG - Intronic
1071527345 10:86366274-86366296 GCCCCCGCCCAGCCTCGGCCCGG + Intronic
1071573812 10:86711753-86711775 GCCGCCGCCCGCCCCCTCCCGGG - Intronic
1072679682 10:97498239-97498261 GGCGCCGCGCGCCTTCCGCATGG - Intronic
1073250992 10:102120224-102120246 GGCCCGGCCCGGCCTCGGCCCGG + Exonic
1075040725 10:119104632-119104654 GCAGCCGCCCGCCCCCGGCTCGG - Intronic
1075801978 10:125159804-125159826 GGCGCGTCGCGCGCTCGGCCTGG + Intronic
1076683594 10:132187126-132187148 GGCGCCCCCTGCCCGCCGCCCGG + Intronic
1076722052 10:132397059-132397081 GCGGCCGCGCGCCCCCGGCCCGG + Intergenic
1076800119 10:132817871-132817893 GGCGTCGGCCGCGCTCTGCCTGG + Intronic
1076829005 10:132985038-132985060 GGGGCCGCCAGCCCTCAGCCTGG - Intergenic
1076895382 10:133308918-133308940 GGCTGCGCCCGCCCGCGCCCGGG + Exonic
1076999678 11:316306-316328 GGCGCCTCCCGCCTTGGGCTCGG - Intergenic
1077017956 11:405238-405260 TCCGCCGCCCACCCTGGGCCTGG + Intergenic
1077038004 11:504478-504500 GGCTCCGCCCGCCCCCGCCTGGG - Intronic
1078245908 11:9573418-9573440 GGCGCCGCCCGAACACCGCCCGG - Intergenic
1078561728 11:12378058-12378080 AGCGGCGCCCGCCCACGGCCCGG - Intronic
1078659907 11:13278104-13278126 GGCGCAGCCTCCCCACGGCCCGG - Intronic
1078771855 11:14358911-14358933 GCTGCCGCCCGCCCTAGGCCCGG + Exonic
1081465444 11:43312271-43312293 GCCGCAGCCCCCGCTCGGCCCGG - Intronic
1081873004 11:46391700-46391722 CCCGCCCCCGGCCCTCGGCCCGG - Intergenic
1083560720 11:63671183-63671205 GCCGCCGCCCTTCCTCGTCCCGG - Intronic
1083583222 11:63838739-63838761 GCCGACGACCGCCCTCGGCAGGG + Intergenic
1083590119 11:63888840-63888862 GGCAGCCCCCGCCCTAGGCCTGG + Intronic
1083605244 11:63974807-63974829 GGCGCCTCCCGCGCTCTTCCAGG - Intronic
1083858208 11:65404430-65404452 GGAGCCGCCCGCCCCTGCCCTGG + Intronic
1084028500 11:66467203-66467225 GGCCCCGCACGCCCCGGGCCCGG - Intronic
1084271318 11:68030809-68030831 GGCGCCGCCAGCTCTGCGCCTGG + Intronic
1084295787 11:68213008-68213030 GGCCCCACCCGCCCTGGCCCCGG + Intronic
1084669040 11:70594588-70594610 GCCCCTGCCCGCCCTCAGCCTGG - Intronic
1084726266 11:70944326-70944348 GGCCCGGCCCGGCCTCTGCCCGG + Intronic
1084891718 11:72240003-72240025 GCCGCCGCCTGCGCCCGGCCTGG - Exonic
1086341787 11:85854975-85854997 GGCGGCGCGGGCGCTCGGCCGGG + Intergenic
1090086493 11:123654704-123654726 GGCTCCGCCCCCGCTCGGCGCGG - Intronic
1090616801 11:128522394-128522416 GGGTCCGCGCGCCCTGGGCCGGG + Intronic
1090699042 11:129278825-129278847 GCTGCCGCCCGCCTTGGGCCCGG + Intronic
1090799242 11:130160207-130160229 AGCCCCGCCCGCCCGCGGCCCGG - Intronic
1091330548 11:134728213-134728235 GGTGACTCCCGCCCTGGGCCTGG + Intergenic
1091383625 12:78244-78266 GGCACCGCCCGCCGCCAGCCCGG + Intronic
1091784070 12:3231697-3231719 GGCGCCGCCCGCCCACAACCTGG - Intronic
1093685086 12:22046216-22046238 GGCGCCGCCCGATCCCCGCCTGG - Exonic
1096468942 12:51864353-51864375 GGCGCCCCCGGCCCGGGGCCCGG + Intergenic
1097269458 12:57765333-57765355 GGGGCCGCCCGCCCTGGTTCGGG - Exonic
1098369304 12:69739405-69739427 GGCCGCGCCCGCCCGCCGCCAGG - Exonic
1099989562 12:89708563-89708585 GCCGCCGCCCGCCCGCGGCCGGG - Intronic
1101918708 12:108915839-108915861 GGCAACGCGGGCCCTCGGCCTGG - Exonic
1102514614 12:113437962-113437984 GGGGCAGGCAGCCCTCGGCCTGG - Exonic
1102948478 12:117011213-117011235 GGCGCCCCCTCCCCTGGGCCCGG + Intronic
1103521291 12:121538050-121538072 GGGGCCCCGCGTCCTCGGCCGGG - Intronic
1103779387 12:123389090-123389112 GGCGCCGCCGGCCCTTCCCCGGG + Intronic
1103779433 12:123389202-123389224 CGCGCCGCCCGCCCCCCGCGCGG - Intronic
1103883783 12:124186168-124186190 GGCGCGGCCCCTCCTCTGCCAGG + Intronic
1105012034 12:132762161-132762183 CGCGCCTCCCGGCCCCGGCCTGG + Intergenic
1105071443 12:133236236-133236258 CGCGCCGCCCGCCCTGGCTCTGG + Intergenic
1106478053 13:30114903-30114925 CGCGCCGTCCACCCCCGGCCGGG + Intergenic
1106517100 13:30465213-30465235 GGGCCCGGCCGGCCTCGGCCCGG - Intronic
1106735890 13:32587055-32587077 CGCGCCGCCCGCCTGCCGCCCGG - Intronic
1106809997 13:33350128-33350150 GGCACCACCCTCCCTGGGCCGGG - Intronic
1108518281 13:51222585-51222607 AGCGCCCCCCGCCCGCGGCCCGG - Intronic
1113437849 13:110307206-110307228 GGCGCCGCCCGCGCACCGCCGGG - Intronic
1114452794 14:22837763-22837785 GGCGCCCCCCACCCTCACCCCGG + Intronic
1114558506 14:23576010-23576032 AGCGCCGCCCGCCCTCATCGAGG - Exonic
1115474668 14:33801110-33801132 GGCGCCGCCCGTCCTGGGCCCGG + Intronic
1115761296 14:36580993-36581015 GCCGCCGCCTGCCCTCTGCCGGG - Exonic
1115768491 14:36647354-36647376 GGTCCCGCCCGGCCGCGGCCTGG + Intergenic
1117805370 14:59484715-59484737 GACCCCGCCCGCCCTCGGGCCGG + Exonic
1118809233 14:69261256-69261278 GGCTCCGCACGCCCCCGCCCGGG - Intronic
1120993614 14:90398301-90398323 GACGCCGCCCCTCCTCGGCCAGG - Intronic
1122108656 14:99480484-99480506 GGCGCCGGTCGGCCTCTGCCCGG - Intronic
1122266464 14:100549157-100549179 GGCCCCTCCCGACCTCGCCCGGG + Intronic
1122623208 14:103071320-103071342 AGCGCCGCCAGCCCTGGGGCTGG - Intergenic
1122904392 14:104795289-104795311 GGGGCCGCCCTCCCTTGGCCGGG + Intronic
1124014410 15:25863357-25863379 CTCGCCGCCCGCCCCCGGCCCGG + Intronic
1127588174 15:60397718-60397740 GGGGCCACCGGCCCTCGGGCCGG - Intronic
1128067431 15:64774093-64774115 GGCGCCGGTGGCCCTCGGCTGGG - Intronic
1129189181 15:73927572-73927594 GCCGCCGCCCCCCGACGGCCTGG + Exonic
1129330879 15:74826553-74826575 CCCGCCGCCCGCCCCCGCCCGGG - Exonic
1130224257 15:82045726-82045748 GCCCCCGCCGGCCCTCGGCTCGG + Exonic
1130224404 15:82046258-82046280 GCCTCCTCCCGCCCCCGGCCTGG - Intergenic
1130305324 15:82709419-82709441 AGCGCTGCCCGCGCTGGGCCGGG + Intronic
1130362796 15:83207130-83207152 GGCCTCGCCCGCACTCCGCCAGG - Intronic
1131517611 15:93089317-93089339 CGCGCCCCCCGCCCGCGGCCCGG - Intergenic
1132583087 16:694213-694235 GGCGCCCCGCGCCCCCGCCCAGG + Exonic
1132656602 16:1044233-1044255 GGAGCCCCCCGCCCTCCTCCTGG + Intergenic
1132719649 16:1309482-1309504 GCCGCCGCGCGCCCGCGCCCCGG - Intronic
1132804931 16:1771039-1771061 GGAGCCGCCCGCCCGCTTCCCGG + Intronic
1132831302 16:1929707-1929729 GGCCACGCCCGCCCTTGGGCCGG - Intergenic
1132868706 16:2106063-2106085 GGGGGCGCCCTCCCACGGCCTGG + Intronic
1132907281 16:2289289-2289311 GCCGCTGCCCGCCCTCTGCCCGG + Intronic
1133072268 16:3254455-3254477 TGCGCAGCCGGACCTCGGCCTGG + Exonic
1133325103 16:4937313-4937335 GACGCCGCCCACCCCCAGCCGGG + Intronic
1133784262 16:8963077-8963099 GCGGCCGCCGGGCCTCGGCCTGG - Intronic
1134522879 16:14926596-14926618 GGGGGCGCCCTCCCACGGCCTGG - Intronic
1134549748 16:15133462-15133484 GGGGGCGCCCTCCCACGGCCTGG + Intronic
1134710547 16:16325247-16325269 GGGGGCGCCCTCCCACGGCCTGG - Intergenic
1134718717 16:16369535-16369557 GGGGGCGCCCTCCCACGGCCTGG - Intergenic
1134949055 16:18343398-18343420 GGGGGCGCCCTCCCACGGCCTGG + Intergenic
1134956038 16:18382624-18382646 GGGGGCGCCCTCCCACGGCCTGG + Intergenic
1136146719 16:28320647-28320669 GGGACCGCCCGCCCGCCGCCGGG + Exonic
1136365262 16:29806606-29806628 GGCGCCGCCCCCGGCCGGCCGGG - Exonic
1136414722 16:30096165-30096187 GGCGCCGTCCCCCCCGGGCCCGG + Exonic
1137683215 16:50368807-50368829 GGCGCCGCACGGCCTGGGCCTGG - Intronic
1139431596 16:66913721-66913743 GGTGCTGCCCTCCCTGGGCCTGG + Intronic
1140442586 16:74999167-74999189 GCCGCGGCCCGCCCGAGGCCTGG + Exonic
1141729093 16:85809862-85809884 GGAGCCGCCTGCCCTGGGCCAGG + Intergenic
1142509782 17:386133-386155 CGCACCCCCCGCCCTCGGACTGG + Intronic
1142637724 17:1268411-1268433 GCCCCCGCCCGCCCCCGCCCGGG + Intergenic
1143318766 17:6054007-6054029 GGCACCGCCTGCCCTGGTCCAGG - Intronic
1144756130 17:17681680-17681702 GGCCCGGCCGGCCCGCGGCCAGG - Exonic
1144847050 17:18225563-18225585 GGCCCCGCGCGCCCGCGCCCGGG + Intergenic
1145214703 17:21042847-21042869 GCCGCCCCCCGCGCGCGGCCGGG - Exonic
1146957215 17:36942694-36942716 GGTCCCGCCGGCCCCCGGCCGGG + Intronic
1147612875 17:41811979-41812001 CGCGCCGCCCGCCCGGGGCCCGG - Exonic
1147972533 17:44227124-44227146 GGCGCAGCCCTGCCTAGGCCCGG - Intergenic
1148106387 17:45121071-45121093 AGCGCCGCAGGCCCTCGGACTGG + Exonic
1148271730 17:46266925-46266947 GGCGGCGCGCGCGCGCGGCCGGG - Intergenic
1148284083 17:46372760-46372782 CCCGCCGCCCGCCCTCGCGCAGG - Intergenic
1148306304 17:46590681-46590703 CCCGCCGCCCGCCCTCGCGCAGG - Exonic
1148438440 17:47699435-47699457 GCAGCCGCTCGCACTCGGCCTGG - Exonic
1148733437 17:49851389-49851411 GCCGCGACCCGCCCCCGGCCCGG - Intergenic
1149486261 17:57045476-57045498 TGCGCCGCCCGCCCCCCGCGAGG - Intergenic
1150216842 17:63476030-63476052 TGCGCCGCCGGGCCTCTGCCAGG + Intergenic
1151478459 17:74356530-74356552 GGCGCCGGCCACCCTAGGGCTGG - Exonic
1151938935 17:77281141-77281163 GGCGGCCCCCACCCCCGGCCTGG + Intronic
1152239810 17:79155365-79155387 GGCACTGCCCGCTCTCGGGCAGG + Intronic
1152394496 17:80024028-80024050 GGCCCCGCCCGCACTCGCCGAGG - Intronic
1152544020 17:80991896-80991918 GGCGGCGCCCGCCCCTGGCCCGG - Exonic
1152593178 17:81223416-81223438 GCCGCCGCACTCCCGCGGCCCGG + Intergenic
1153238951 18:3013449-3013471 GGCCCCGCCCTCACTTGGCCAGG - Intergenic
1154214874 18:12408319-12408341 GGCTCCGGCCGCCCCCGCCCCGG - Intronic
1154501401 18:14999593-14999615 TGGGCCTCCCGCCCTCGGCTGGG + Intergenic
1155152847 18:23136043-23136065 GGCGCCGCCGGCGCCCGGCTTGG - Exonic
1155392465 18:25351030-25351052 GGCGCCTCGCGCCCTCCGCTCGG + Intronic
1156213883 18:34977151-34977173 GGCGCAGCCAGCCCCTGGCCTGG - Intronic
1157279153 18:46334388-46334410 CGCGGCGCCCGCCCCCGCCCCGG - Intronic
1157833665 18:50879357-50879379 GGCGCCGGCCTCCCCTGGCCCGG + Intronic
1159770427 18:72541930-72541952 GGCGCCGTCCGCCGACGGGCTGG + Exonic
1160164115 18:76495323-76495345 CGCGCCGCCCGCGCGCGCCCCGG + Intergenic
1160736118 19:663140-663162 CGCGCCGCCCGCCCCCCGCGCGG + Exonic
1160765305 19:804957-804979 GACGGCGCCCGCCCTGGCCCTGG + Intronic
1160947968 19:1652272-1652294 CGCGCCCCCCGCCCCCCGCCGGG + Intronic
1161210440 19:3062650-3062672 GGCCCGGCCCGCCCCCGCCCCGG + Intronic
1161238128 19:3207970-3207992 GGAGCCGGCCGCCCTCGGTCTGG + Exonic
1161264612 19:3358637-3358659 GGCGCTGACCCACCTCGGCCCGG + Intergenic
1161560392 19:4969506-4969528 GCCCCCGCGCGCCCCCGGCCCGG - Intronic
1161959616 19:7516369-7516391 CGCGCCGCCGGCCCTGGCCCAGG + Intronic
1162027869 19:7904460-7904482 GGCGCCCCCCTCCCCCGGCCTGG + Intronic
1162312147 19:9913914-9913936 GGCGCCCCCCGCCCCCCGCCGGG - Intronic
1162959497 19:14117635-14117657 GGCGGCGGCGGCCCTCGGGCTGG + Exonic
1163488957 19:17605923-17605945 GGCGCAGCCCACCCTTGGCGTGG + Exonic
1163725191 19:18919324-18919346 GGCGCCTCCGGCCCCCGGCCCGG - Exonic
1164830392 19:31315506-31315528 GGCCCCTCCTGCCCTCTGCCAGG + Intronic
1165058734 19:33194757-33194779 GGCGGCGCCCGCGGGCGGCCGGG + Exonic
1165386672 19:35514077-35514099 GGCATTGCCCGTCCTCGGCCTGG + Intergenic
1165851460 19:38852239-38852261 GGCGCCGCCCGCCAGTGCCCCGG + Intronic
1166045271 19:40226322-40226344 GGCGACGCCGGCCCACCGCCCGG - Intronic
1166305158 19:41933107-41933129 GCCACCTCGCGCCCTCGGCCTGG - Intergenic
1166547001 19:43639809-43639831 GCCGCCGCTCGCTCCCGGCCCGG + Exonic
1166702669 19:44891288-44891310 GGCGGCGCCTGCTCCCGGCCTGG - Exonic
1166957019 19:46471457-46471479 GGCGCCGTCCGCCCCCGCTCCGG + Exonic
1167040561 19:47020645-47020667 GGAGGCGCCCGCCCCCCGCCCGG + Intronic
1167075198 19:47244234-47244256 GGGGCCGCCCGGCCTCCGCCTGG - Intergenic
1167375379 19:49108203-49108225 GGCGCCGCTCGCGCTCGCTCCGG - Exonic
1168064045 19:53909389-53909411 CGCGCCCCCCGCCCCCGCCCCGG - Exonic
1168103422 19:54153051-54153073 GCCGCCGTCCCCCCTCGGGCTGG + Intronic
1168311243 19:55461845-55461867 GGCACCGCCCCCCCTGGGGCGGG - Intronic
925107653 2:1306657-1306679 GGCTCCAGCCTCCCTCGGCCAGG + Intronic
925984959 2:9207552-9207574 GCCGCCGCCCGCCGCCGCCCGGG + Intronic
927679777 2:25131925-25131947 GGCCCCGCCCCGCCCCGGCCCGG - Intronic
930782128 2:55233162-55233184 GCCGCCGCCCGCTCTGGGCTGGG + Intronic
931467670 2:62505832-62505854 GCGGCCTCCCGCCCCCGGCCGGG - Intronic
932331683 2:70901485-70901507 GGCGCCGCCTTCCCGCGGCCTGG + Intronic
932396775 2:71454093-71454115 GGGGCCGACCACCCTCGCCCGGG + Intronic
934188622 2:89766213-89766235 TGCTCCGGCTGCCCTCGGCCTGG - Intergenic
934296844 2:91749107-91749129 GGCGCCGCCGGCCCTTCCCCGGG - Intergenic
934718427 2:96556515-96556537 GGCTCCCCCCGCCCCCAGCCAGG + Intergenic
934761104 2:96857692-96857714 GGCCCCGCACGAGCTCGGCCAGG - Intronic
934763985 2:96870200-96870222 GGACCCGCCCGCTCTCCGCCCGG + Intronic
935112429 2:100105162-100105184 GGCCCCGCCCGGCCTTGCCCGGG + Intronic
935137577 2:100321499-100321521 TGCGCAGCCGGCACTCGGCCGGG + Exonic
936126694 2:109794574-109794596 GCCGCCGCCGCCCCCCGGCCGGG - Intronic
937208654 2:120253075-120253097 GCCGCCGCCCGGCCACAGCCCGG - Intronic
938500579 2:131829784-131829806 TGGGCCTCCCGCCCTCGGCGGGG + Intergenic
941110410 2:161414766-161414788 GGCGGAGCCCGCCCTCGGGCCGG + Intergenic
944221657 2:197310209-197310231 GGCGCCGCCGGCCCGGGCCCCGG - Intronic
946362813 2:219229299-219229321 GGAGCTGCCAGCCCTTGGCCTGG - Exonic
946727121 2:222671761-222671783 GGCGCCGTCCTCGCCCGGCCAGG + Intronic
947399114 2:229714572-229714594 GGCCCCGCCCGCCGTTGCCCGGG - Intergenic
947731326 2:232433143-232433165 GGCGCCTCCTCCCCTCTGCCAGG - Intergenic
948115859 2:235494072-235494094 AGCGCCGCCCGCCGCCTGCCCGG - Intronic
948824691 2:240568524-240568546 GGCGCCCCTCGCCCGCGGCCCGG + Intronic
948824730 2:240568655-240568677 GCCGCCGCCCGCCCTGGACGTGG + Intronic
1168795982 20:610368-610390 GGAGCCCTCCGCCCCCGGCCGGG - Exonic
1169051009 20:2577849-2577871 TGCGCCACCTGCACTCGGCCTGG + Intronic
1169367272 20:5001545-5001567 GGAGCCGCCCGCCCCCGCGCCGG + Intronic
1170524770 20:17226855-17226877 GCCCCCGCCCACCCCCGGCCCGG - Intronic
1170688162 20:18587899-18587921 GGCCACGCCCACTCTCGGCCTGG - Exonic
1172073670 20:32277736-32277758 GCCGCCGCCCGCTTTCGGCTCGG + Exonic
1172284635 20:33732123-33732145 GCCGCTGCGCGCCCTAGGCCGGG - Intronic
1172336654 20:34122427-34122449 GCCTCCGCCCGGCCTCCGCCCGG - Intergenic
1172569184 20:35955708-35955730 GGCCCTGACAGCCCTCGGCCAGG + Intronic
1172661797 20:36573672-36573694 GGCGCCCCCCGCTCCCCGCCGGG + Intronic
1172703044 20:36864018-36864040 AGGTCCGCCCGGCCTCGGCCCGG - Intergenic
1173279785 20:41618132-41618154 GCCGCCGCCTGCCCTCCGCCAGG + Intronic
1174504703 20:51009723-51009745 GGCGGCCCTCGCCCTCGGCCGGG + Exonic
1175219577 20:57409144-57409166 GCTGCCCCCCGCCCTCGGCCAGG - Exonic
1175402201 20:58707208-58707230 GGCCCTGCCCGCCCTCTGCAGGG + Intronic
1175859421 20:62142646-62142668 GGAGGCGCCCGCCACCGGCCAGG + Intronic
1175903084 20:62367525-62367547 GGCGCCGTCGTCCCACGGCCTGG - Intergenic
1175911370 20:62406931-62406953 GGTGCCCACCGGCCTCGGCCTGG - Exonic
1176274458 20:64255885-64255907 GCCGCCGCCGCCCCTCGGTCCGG + Intronic
1176382947 21:6122441-6122463 GGCGGTGCCTGCCCTGGGCCGGG + Exonic
1179491886 21:41746273-41746295 GACGCCGCCGGCCACCGGCCAGG + Intronic
1179511862 21:41878916-41878938 CCCCCCGCCCGCCCGCGGCCAGG - Intronic
1179740522 21:43415798-43415820 GGCGGTGCCTGCCCTGGGCCGGG - Exonic
1179968321 21:44819020-44819042 GGCCTCCCCCGCCTTCGGCCGGG - Intergenic
1180843769 22:18970828-18970850 GGCTCCGCCCTCCCGGGGCCGGG - Intergenic
1181026970 22:20132148-20132170 CGCCCCGCCCGCCCACTGCCCGG - Intronic
1181057704 22:20267878-20267900 GGCTCCGCCCTCCCGGGGCCGGG + Intronic
1182122551 22:27797228-27797250 GCCCCCGCCCGCCCTCGGCCTGG - Exonic
1182435437 22:30326834-30326856 GGCCGCGCGCGCCCGCGGCCGGG - Exonic
1183079436 22:35447104-35447126 GATGCTGCACGCCCTCGGCCAGG - Intergenic
1183428866 22:37753871-37753893 GTCGCGGCCCGCCCACTGCCAGG - Intronic
1184711167 22:46250298-46250320 GGCCCCGCCCCACCGCGGCCCGG + Exonic
1185037854 22:48489242-48489264 GGCGCCGCGTCCCCTCTGCCAGG + Intergenic
1185271121 22:49929659-49929681 GGAGCCGCCCGGCCTGGGTCGGG + Intergenic
950650277 3:14402812-14402834 GGCGCCGCCCGCGCTCTGCTCGG - Exonic
954004083 3:47578459-47578481 TCCGCCGCCCGGCCGCGGCCAGG + Intronic
954004087 3:47578466-47578488 GGCACCGCCTGGCCGCGGCCGGG - Intronic
954194829 3:48990328-48990350 GGCGCCGCCAGACCACTGCCAGG + Exonic
954733520 3:52685720-52685742 GGCCCCACCCGCCCTGGGCCCGG + Intronic
955818802 3:62874871-62874893 GGCGCCGCCGCCCCCCAGCCCGG + Exonic
959085636 3:101849133-101849155 TGCGCCGCGCGCCCTCTCCCCGG + Intronic
959085815 3:101849742-101849764 GTCGCCGCCCGCCGCCGCCCCGG + Exonic
959539868 3:107525236-107525258 GGCACCGCCGGCGCCCGGCCCGG - Intronic
960998064 3:123352342-123352364 AGCACTGCCCGCCCTAGGCCAGG + Intronic
961359110 3:126356476-126356498 GCCGCCGCCATCCCTCGGTCAGG + Intronic
961574472 3:127823269-127823291 CGCGCCGCCCGCCGCCCGCCGGG - Intergenic
961665866 3:128492842-128492864 GGCCCTTCCCGCCCCCGGCCCGG - Intronic
961736287 3:129003928-129003950 CGCGCCGCCGCACCTCGGCCTGG - Exonic
963081871 3:141402302-141402324 GGCCCGGCCCGCCCCCGGCGCGG - Intronic
963133111 3:141876527-141876549 GCCGCCTCCCGCCAGCGGCCGGG - Intronic
964757384 3:160100796-160100818 GGCGCCGCACGGCCTCGGCCTGG + Intergenic
966594314 3:181712308-181712330 GCGGCCGCCGACCCTCGGCCCGG - Exonic
966919331 3:184601926-184601948 GGCGGAGCCGGCCCCCGGCCCGG - Intronic
968225271 3:196968976-196968998 GGCGCCGCCGTCCCTCGGGCCGG + Intronic
968440578 4:621983-622005 GGCGGCCGCGGCCCTCGGCCTGG - Intergenic
968514250 4:1009775-1009797 GGCCCCGCCCCCGCCCGGCCAGG + Intergenic
970456083 4:16226114-16226136 GGCTCCGCGCGCCCACAGCCTGG + Intronic
971207472 4:24584295-24584317 GCCGCCTCGCGCCCCCGGCCTGG + Intronic
973774883 4:54233502-54233524 GGCGCCGACCGCCCGGGGCTGGG - Intronic
974385915 4:61201803-61201825 GCCGCCGCCTGCGCCCGGCCAGG - Intronic
977177496 4:93834836-93834858 GCCGTCTCCCGCACTCGGCCGGG + Intergenic
977400055 4:96521193-96521215 GGCTCCGCGGGCCCTGGGCCTGG + Intergenic
977908169 4:102501184-102501206 GGCGCTGTGCGCCCCCGGCCCGG - Intergenic
978384876 4:108168786-108168808 GGCGTCCCCTCCCCTCGGCCGGG - Intronic
981475086 4:145180047-145180069 GCCGCCGCCTGCCCCAGGCCGGG - Intronic
985445504 4:190019210-190019232 GGAGCCGCTCGCCCGCGGCCGGG - Intergenic
987082821 5:14441051-14441073 GCCGGCGCCAGCCCACGGCCCGG - Intronic
987193176 5:15500160-15500182 GGCGCAGCTCGCCCGCGGGCCGG - Intergenic
991216807 5:64165672-64165694 GGCGCCGCCCACGCGCGGCTCGG + Intergenic
992080896 5:73233746-73233768 GACCCCGCCCGCGCTGGGCCGGG + Intergenic
992105891 5:73448595-73448617 GGCTCCGCTCGCGCCCGGCCCGG + Intergenic
992484281 5:77180432-77180454 GGAGCCGCCCGCCGCCGGCATGG + Intergenic
992765050 5:79990967-79990989 GTCGCCGCCGGCCTTCGGCGGGG + Intronic
993904122 5:93604322-93604344 GGCGCGGCCAGCCCGAGGCCCGG - Intergenic
994367007 5:98928462-98928484 CGCCGCGCCCGCCCTCCGCCCGG + Intronic
995140347 5:108728345-108728367 GGAGCCGCCCACCTTCGGGCTGG + Intergenic
1002198470 5:177513663-177513685 GGTGCCGCCCCCGCCCGGCCAGG - Exonic
1002296148 5:178232465-178232487 CCCGCCGCCCGCCCCCCGCCCGG + Intronic
1002409175 5:179060608-179060630 GGCGCCGTCCGCGAGCGGCCTGG + Exonic
1002926781 6:1609717-1609739 CGCGCCGGCCGCCCTGGCCCGGG - Intergenic
1003167470 6:3693377-3693399 ACTGCCGCCTGCCCTCGGCCAGG - Intergenic
1003290587 6:4776038-4776060 GGTCCCGCCTGCCCTGGGCCGGG + Intronic
1005755735 6:28923735-28923757 GGCGCCGCCCTCCGTCCGCCCGG - Exonic
1007589818 6:43014323-43014345 GGCCCCGCCCCGGCTCGGCCTGG + Exonic
1007702238 6:43771948-43771970 CGCGCCGCGCGCACCCGGCCGGG - Intronic
1007784085 6:44270524-44270546 GGCCCCGGCCCCCCCCGGCCCGG + Exonic
1007902265 6:45422970-45422992 ACCGCCCCCCGCCCCCGGCCGGG + Intronic
1010083249 6:71887309-71887331 GGAGGCGCCCGCCTTGGGCCAGG + Intronic
1011633924 6:89352907-89352929 TGCGTCACCCGCCCTCGTCCGGG + Intergenic
1015924053 6:138292060-138292082 GGCGCCGGCCTCCCACGCCCCGG + Intronic
1017662456 6:156687535-156687557 GGCGCCGCCCGCTCCGCGCCCGG - Intergenic
1017877552 6:158536933-158536955 GGCGCGCCCCGGCCTTGGCCTGG + Intronic
1018056581 6:160057211-160057233 GGCTCCTCCCGCCTTCTGCCCGG + Intronic
1018613192 6:165662630-165662652 CGCTCCGCCCGGCCACGGCCAGG + Intronic
1018686533 6:166308100-166308122 GCCGCCGCCCGCCCCCGCCCCGG - Exonic
1019351689 7:557037-557059 GGCCCCTCCCACCCCCGGCCTGG + Intronic
1019937392 7:4265302-4265324 GACGCCGCCCGCGCTCTGCGTGG - Exonic
1020050828 7:5080508-5080530 GGAGCAGCCCGCACTGGGCCTGG + Intergenic
1020066134 7:5190072-5190094 GCCGCCGCTCGCCCTCAGCCAGG + Intergenic
1020106117 7:5423174-5423196 GGAACCGCCGCCCCTCGGCCGGG + Intronic
1020260192 7:6526666-6526688 GTCGCTGCGCGCCCTGGGCCCGG + Exonic
1021668666 7:23013653-23013675 GGCGCAGCCTGCCCGCTGCCTGG - Intronic
1022396031 7:29989163-29989185 GACGCCCGCCGCCTTCGGCCCGG - Intronic
1023879464 7:44309942-44309964 CGAGCCGCGCGGCCTCGGCCTGG - Intronic
1023965929 7:44963061-44963083 GGTGCTGCACGCCCGCGGCCAGG - Exonic
1027982981 7:85250279-85250301 GGCGCCCCCCCCCCCCGGCCTGG - Intergenic
1028985660 7:97006524-97006546 GGCCCCGCGCGCCCTTGGCCGGG + Intronic
1029205992 7:98869723-98869745 GCCGCAGCCCGCCCGGGGCCTGG - Intronic
1029456630 7:100675210-100675232 GGGGCCGCCCGCCCGCGCCTGGG + Intronic
1029640542 7:101816773-101816795 GGCGCGGCCCGGCTCCGGCCAGG + Intronic
1032306115 7:130733797-130733819 GGCGCCGCCCGCGCCGGGGCTGG + Exonic
1033223614 7:139544420-139544442 GGAGCCGCCTGCCCTCTGCAAGG + Exonic
1034343494 7:150372201-150372223 GGCCCAGGCCGCCCCCGGCCCGG + Exonic
1034977788 7:155458199-155458221 GTCGCCGGCCGCGCTCGGCGCGG - Exonic
1035073065 7:156158932-156158954 GGCGGAGCCAGGCCTCGGCCCGG + Intergenic
1035450401 7:158973949-158973971 CGCGCCCCCCACCCTCGCCCAGG + Intergenic
1035450419 7:158973988-158974010 CGCGCCCCCCACCCTCGCCCAGG + Intergenic
1035450438 7:158974028-158974050 CGCGCCCCCCACCCTCGCCCAGG + Intergenic
1036398209 8:8386416-8386438 GAAGCCACCCGCCCGCGGCCGGG - Exonic
1039949052 8:42153416-42153438 GTCGCCGCCGGCTCTGGGCCGGG + Intronic
1041167258 8:55102316-55102338 GCCGCCGCCCGCCGCCCGCCGGG - Intergenic
1042484040 8:69332024-69332046 GGCTCAGCCCGCACTGGGCCAGG + Intergenic
1043428471 8:80171592-80171614 GGCGCCGCCCGCCCTCGGCCTGG + Intronic
1043502678 8:80873443-80873465 GCCGCTGACCGTCCTCGGCCAGG + Intronic
1043954322 8:86343022-86343044 GGCGCCGTCCGCCCCCGGGCTGG + Intronic
1044822005 8:96161069-96161091 GGCGCTGCCGGCCCGTGGCCGGG + Intergenic
1045023567 8:98064742-98064764 GGCGCCGCCCGCGCCCGGGCTGG + Intronic
1046547303 8:115668466-115668488 GGCGCGGGCGCCCCTCGGCCGGG - Intronic
1048554048 8:135457812-135457834 GGCGCCGCCCCCCGTGCGCCTGG + Exonic
1049785935 8:144450844-144450866 GGCTGAGCCTGCCCTCGGCCTGG - Intronic
1049818412 8:144619266-144619288 GGCGACGCCCGCCATAGACCAGG + Intergenic
1053229959 9:36400372-36400394 GGAGCCGCCGGCCCGCTGCCCGG - Intronic
1053482259 9:38424319-38424341 GGCGCCGGCCGCCCACGTCGCGG + Exonic
1054781942 9:69174022-69174044 GCCGCCTCCCGCCCCCGGCCAGG + Intronic
1056732445 9:89178019-89178041 GGCGCCGCACGCCAGCGACCAGG - Exonic
1057758353 9:97854025-97854047 GGCGCCGCCCGCCCGCCCCGCGG - Exonic
1060280796 9:122214225-122214247 GGCCCCGCCCACTTTCGGCCCGG + Intronic
1060514662 9:124258173-124258195 GCGCGCGCCCGCCCTCGGCCCGG - Intronic
1061108903 9:128552899-128552921 GGCGGCGCCGAGCCTCGGCCCGG - Intronic
1061128206 9:128689734-128689756 GGCGCCCCCCGCGCGCGCCCCGG - Intronic
1061237789 9:129352321-129352343 GGCGCCCCCAACCCGCGGCCAGG - Intergenic
1061902360 9:133679518-133679540 GGCGGGGCCCGTCCTCGGCAGGG + Intronic
1061975988 9:134068203-134068225 GGCCAGGCCCGCTCTCGGCCGGG - Intronic
1062160252 9:135075895-135075917 GCCGCCCCGCGCCCCCGGCCTGG + Intronic
1062230640 9:135479897-135479919 AGCGCGCTCCGCCCTCGGCCGGG - Exonic
1062460079 9:136659333-136659355 AGCGCCCCCCGGCCTCGGACGGG - Exonic
1062499105 9:136844754-136844776 TGGGCCTCCCGCCCTCGGCGGGG - Exonic
1062525920 9:136978114-136978136 GGCGACGCGCGCTCTCGCCCGGG + Intronic
1187464593 X:19515607-19515629 GGCAGCGCCCGCCCGCAGCCGGG + Intergenic
1189271489 X:39755252-39755274 GGGGCTGCCCCTCCTCGGCCTGG + Intergenic
1189323040 X:40097650-40097672 GCCGCCGCCCGCGCTCGGGCAGG + Intronic
1192363808 X:70455063-70455085 GGCGCCTGCCGCCCTCCTCCTGG - Intronic
1192509165 X:71711992-71712014 GGCTCCACCCGCCCATGGCCTGG + Intergenic
1192517532 X:71769561-71769583 GGCTCCACCCGCCCATGGCCTGG - Intergenic
1195668429 X:107450131-107450153 GGCGCCCCCCGCCCTGCCCCCGG - Intergenic
1195884406 X:109624609-109624631 GGGGCTGCCTGCCCTCGCCCAGG - Exonic
1198276320 X:135098325-135098347 GTCCCCGCCCGCCCCCGGCCGGG - Intergenic
1198310188 X:135422415-135422437 GTCCCCGCCCGCCCCCGGCCGGG + Intergenic
1199264806 X:145817892-145817914 GGCGCCGCCCGCGCTCCCCGCGG + Intronic
1200128959 X:153830780-153830802 GGCGGCCCCCGCCCGCGGCCAGG + Intergenic