ID: 1043429974

View in Genome Browser
Species Human (GRCh38)
Location 8:80185240-80185262
Sequence CTGAATATACAAATGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043429971_1043429974 28 Left 1043429971 8:80185189-80185211 CCTGGGCGACAGAGCAAGATTCT 0: 265
1: 7623
2: 46554
3: 122082
4: 165292
Right 1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043429974 Original CRISPR CTGAATATACAAATGGACAT TGG Intronic
No off target data available for this crispr