ID: 1043432091

View in Genome Browser
Species Human (GRCh38)
Location 8:80205018-80205040
Sequence TAATAGTTACAGATTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043432088_1043432091 19 Left 1043432088 8:80204976-80204998 CCAAATCCGGGGCAATTTTGGAC 0: 1
1: 0
2: 0
3: 9
4: 45
Right 1043432091 8:80205018-80205040 TAATAGTTACAGATTGAGGCTGG No data
1043432085_1043432091 27 Left 1043432085 8:80204968-80204990 CCCACTGGCCAAATCCGGGGCAA 0: 1
1: 3
2: 32
3: 116
4: 352
Right 1043432091 8:80205018-80205040 TAATAGTTACAGATTGAGGCTGG No data
1043432086_1043432091 26 Left 1043432086 8:80204969-80204991 CCACTGGCCAAATCCGGGGCAAT 0: 1
1: 1
2: 34
3: 125
4: 332
Right 1043432091 8:80205018-80205040 TAATAGTTACAGATTGAGGCTGG No data
1043432089_1043432091 13 Left 1043432089 8:80204982-80205004 CCGGGGCAATTTTGGACAATATT 0: 1
1: 0
2: 1
3: 17
4: 202
Right 1043432091 8:80205018-80205040 TAATAGTTACAGATTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043432091 Original CRISPR TAATAGTTACAGATTGAGGC TGG Intronic
No off target data available for this crispr