ID: 1043437061

View in Genome Browser
Species Human (GRCh38)
Location 8:80245164-80245186
Sequence CTATTGATGAACTATGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043437057_1043437061 30 Left 1043437057 8:80245111-80245133 CCTGTCTCAAAAATAAATAGATA 0: 8
1: 766
2: 1288
3: 2944
4: 24230
Right 1043437061 8:80245164-80245186 CTATTGATGAACTATGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043437061 Original CRISPR CTATTGATGAACTATGTCCC AGG Intergenic
No off target data available for this crispr