ID: 1043438195

View in Genome Browser
Species Human (GRCh38)
Location 8:80254383-80254405
Sequence ATAGAGGAGAAGAATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043438186_1043438195 24 Left 1043438186 8:80254336-80254358 CCAGTGAAGAAACACTGGACGCT No data
Right 1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043438195 Original CRISPR ATAGAGGAGAAGAATGAGGG TGG Intergenic
No off target data available for this crispr