ID: 1043441837

View in Genome Browser
Species Human (GRCh38)
Location 8:80283159-80283181
Sequence AGGGATGCACATCTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043441830_1043441837 0 Left 1043441830 8:80283136-80283158 CCTTTCTGTGCCCTCCTCAGGGT No data
Right 1043441837 8:80283159-80283181 AGGGATGCACATCTGGAGCCAGG No data
1043441826_1043441837 19 Left 1043441826 8:80283117-80283139 CCAAACCTCAGTGGACATGCCTT No data
Right 1043441837 8:80283159-80283181 AGGGATGCACATCTGGAGCCAGG No data
1043441833_1043441837 -10 Left 1043441833 8:80283146-80283168 CCCTCCTCAGGGTAGGGATGCAC No data
Right 1043441837 8:80283159-80283181 AGGGATGCACATCTGGAGCCAGG No data
1043441827_1043441837 14 Left 1043441827 8:80283122-80283144 CCTCAGTGGACATGCCTTTCTGT No data
Right 1043441837 8:80283159-80283181 AGGGATGCACATCTGGAGCCAGG No data
1043441825_1043441837 20 Left 1043441825 8:80283116-80283138 CCCAAACCTCAGTGGACATGCCT No data
Right 1043441837 8:80283159-80283181 AGGGATGCACATCTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043441837 Original CRISPR AGGGATGCACATCTGGAGCC AGG Intergenic
No off target data available for this crispr