ID: 1043442103

View in Genome Browser
Species Human (GRCh38)
Location 8:80285288-80285310
Sequence CTGTCTGTGCAGATGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043442102_1043442103 -4 Left 1043442102 8:80285269-80285291 CCTGCAGCTCTATTTCTCACTGT No data
Right 1043442103 8:80285288-80285310 CTGTCTGTGCAGATGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043442103 Original CRISPR CTGTCTGTGCAGATGTCAGA AGG Intergenic
No off target data available for this crispr