ID: 1043449008

View in Genome Browser
Species Human (GRCh38)
Location 8:80348327-80348349
Sequence CAATAGACATTCTGTGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043449008_1043449012 19 Left 1043449008 8:80348327-80348349 CCAATTGCACAGAATGTCTATTG No data
Right 1043449012 8:80348369-80348391 TCTGTTTCTCTGCTTCTTTTGGG No data
1043449008_1043449011 18 Left 1043449008 8:80348327-80348349 CCAATTGCACAGAATGTCTATTG No data
Right 1043449011 8:80348368-80348390 TTCTGTTTCTCTGCTTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043449008 Original CRISPR CAATAGACATTCTGTGCAAT TGG (reversed) Intergenic
No off target data available for this crispr