ID: 1043450961

View in Genome Browser
Species Human (GRCh38)
Location 8:80366252-80366274
Sequence TAATTTTACTAAAGGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043450958_1043450961 3 Left 1043450958 8:80366226-80366248 CCGAAGCTGGGTAGAAAATATAA No data
Right 1043450961 8:80366252-80366274 TAATTTTACTAAAGGGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043450961 Original CRISPR TAATTTTACTAAAGGGCAAA TGG Intergenic
No off target data available for this crispr