ID: 1043454277

View in Genome Browser
Species Human (GRCh38)
Location 8:80398410-80398432
Sequence GCTTCTGCACTGAGGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043454273_1043454277 -9 Left 1043454273 8:80398396-80398418 CCAGATCCACATCTGCTTCTGCA No data
Right 1043454277 8:80398410-80398432 GCTTCTGCACTGAGGGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043454277 Original CRISPR GCTTCTGCACTGAGGGTCCA TGG Intergenic
No off target data available for this crispr