ID: 1043457221

View in Genome Browser
Species Human (GRCh38)
Location 8:80424706-80424728
Sequence GCTGGAAAGCAAAGCCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043457221_1043457227 19 Left 1043457221 8:80424706-80424728 CCTTCTAGGCTTTGCTTTCCAGC No data
Right 1043457227 8:80424748-80424770 TCCCTTTCTCCTATGCCAAGAGG No data
1043457221_1043457229 20 Left 1043457221 8:80424706-80424728 CCTTCTAGGCTTTGCTTTCCAGC No data
Right 1043457229 8:80424749-80424771 CCCTTTCTCCTATGCCAAGAGGG No data
1043457221_1043457222 -7 Left 1043457221 8:80424706-80424728 CCTTCTAGGCTTTGCTTTCCAGC No data
Right 1043457222 8:80424722-80424744 TTCCAGCCATTTCCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043457221 Original CRISPR GCTGGAAAGCAAAGCCTAGA AGG (reversed) Intergenic
No off target data available for this crispr