ID: 1043462822

View in Genome Browser
Species Human (GRCh38)
Location 8:80478043-80478065
Sequence CATTTGCTTTGAGAACTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043462822_1043462828 4 Left 1043462822 8:80478043-80478065 CCAGATAGTTCTCAAAGCAAATG No data
Right 1043462828 8:80478070-80478092 GGAGGGAAGGAGGAGAGTGTTGG No data
1043462822_1043462831 30 Left 1043462822 8:80478043-80478065 CCAGATAGTTCTCAAAGCAAATG No data
Right 1043462831 8:80478096-80478118 GATGAGGCTGGAGCAGTACATGG No data
1043462822_1043462830 18 Left 1043462822 8:80478043-80478065 CCAGATAGTTCTCAAAGCAAATG No data
Right 1043462830 8:80478084-80478106 GAGTGTTGGAGAGATGAGGCTGG No data
1043462822_1043462827 -6 Left 1043462822 8:80478043-80478065 CCAGATAGTTCTCAAAGCAAATG No data
Right 1043462827 8:80478060-80478082 CAAATGTGAAGGAGGGAAGGAGG No data
1043462822_1043462826 -9 Left 1043462822 8:80478043-80478065 CCAGATAGTTCTCAAAGCAAATG No data
Right 1043462826 8:80478057-80478079 AAGCAAATGTGAAGGAGGGAAGG No data
1043462822_1043462829 14 Left 1043462822 8:80478043-80478065 CCAGATAGTTCTCAAAGCAAATG No data
Right 1043462829 8:80478080-80478102 AGGAGAGTGTTGGAGAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043462822 Original CRISPR CATTTGCTTTGAGAACTATC TGG (reversed) Intergenic
No off target data available for this crispr