ID: 1043463039

View in Genome Browser
Species Human (GRCh38)
Location 8:80479613-80479635
Sequence TAGAATAAATGGAAGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043463034_1043463039 8 Left 1043463034 8:80479582-80479604 CCATGATGCATATAAATAGTATA No data
Right 1043463039 8:80479613-80479635 TAGAATAAATGGAAGGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043463039 Original CRISPR TAGAATAAATGGAAGGTCAA GGG Intergenic
No off target data available for this crispr