ID: 1043464046

View in Genome Browser
Species Human (GRCh38)
Location 8:80487241-80487263
Sequence AGACCTCGGTGTGGCCCTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 3, 3: 5, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043464039_1043464046 -9 Left 1043464039 8:80487227-80487249 CCGCGGCCGCCCCGAGACCTCGG 0: 1
1: 0
2: 1
3: 20
4: 286
Right 1043464046 8:80487241-80487263 AGACCTCGGTGTGGCCCTTGAGG 0: 1
1: 0
2: 3
3: 5
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043464046 Original CRISPR AGACCTCGGTGTGGCCCTTG AGG Exonic