ID: 1043465679

View in Genome Browser
Species Human (GRCh38)
Location 8:80504641-80504663
Sequence CAGTATGTGCATATTCTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043465679_1043465684 22 Left 1043465679 8:80504641-80504663 CCTAAGAGAATATGCACATACTG 0: 1
1: 0
2: 0
3: 18
4: 194
Right 1043465684 8:80504686-80504708 GTCAGCAAAAACTAAAATCTGGG No data
1043465679_1043465683 21 Left 1043465679 8:80504641-80504663 CCTAAGAGAATATGCACATACTG 0: 1
1: 0
2: 0
3: 18
4: 194
Right 1043465683 8:80504685-80504707 TGTCAGCAAAAACTAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043465679 Original CRISPR CAGTATGTGCATATTCTCTT AGG (reversed) Intronic
902338777 1:15769037-15769059 TCGTATGTGCATAGTGTCTTTGG - Intronic
905047563 1:35019359-35019381 CAGTTTGTGCAGGTTTTCTTGGG + Exonic
907097477 1:51794798-51794820 AAGTATTTGAATTTTCTCTTTGG - Intronic
915614741 1:157028733-157028755 GATTATTTGCATATTTTCTTTGG - Intronic
918760347 1:188396951-188396973 CAGTGTTGGCATTTTCTCTTAGG - Intergenic
920694538 1:208172180-208172202 CAATATGTGCATCTTTCCTTTGG - Intronic
920954307 1:210603597-210603619 GAGTATGTGCATATTATTTTAGG - Intronic
921079590 1:211727907-211727929 CTGTGTGTGCATATGCTCTAAGG + Intergenic
921608271 1:217180072-217180094 GAGTATCTGCGTATTATCTTTGG - Intergenic
922060775 1:222089165-222089187 CAGTATGTGCATATGCTTCTTGG - Intergenic
922232860 1:223701516-223701538 CAGCATTTCCATATTCTCTCTGG + Intergenic
922365445 1:224859294-224859316 AAGTATGTGCTCATTTTCTTGGG + Intergenic
923211824 1:231810509-231810531 TAGCTTGTGCTTATTCTCTTTGG - Intronic
1063818347 10:9804523-9804545 CAATAAGTGCATTTTCTCATGGG - Intergenic
1066584293 10:36914580-36914602 GAGGATGTGAATACTCTCTTTGG + Intergenic
1066808566 10:39292386-39292408 CAGTATGTACACACTCTTTTTGG - Intergenic
1067241670 10:44500729-44500751 CAGTTTCTTCATATCCTCTTCGG + Intergenic
1068013109 10:51479623-51479645 CTCGATGTGCATATTCTCATTGG + Intronic
1068076713 10:52264872-52264894 ATTTATGTTCATATTCTCTTCGG - Intronic
1068422591 10:56815420-56815442 CATTTTGATCATATTCTCTTGGG + Intergenic
1069276679 10:66599879-66599901 GAGTAAGTGTACATTCTCTTAGG + Intronic
1069332890 10:67314095-67314117 AATTATGTGCATCTTCTTTTTGG - Intronic
1069910571 10:71756537-71756559 GAGTATGTGCATTTTCTTTTAGG + Intronic
1070408828 10:76120667-76120689 CAGTATGTGCTGATCCTCTTAGG + Intronic
1071375370 10:84996875-84996897 CAGTAAGTTTATATTCTCCTGGG - Intergenic
1074470230 10:113720190-113720212 CAGTATGTGCACTTTCTATGTGG - Intronic
1074696783 10:116056980-116057002 CAGAATGTACATAGTCCCTTTGG - Intronic
1074951026 10:118336087-118336109 CAGAATGTGCATGTATTCTTGGG - Intronic
1075474074 10:122718170-122718192 CAGTATGTGAATATTCAGTGTGG + Intergenic
1083985662 11:66213429-66213451 CAGAATGAGCAGATTCTCTGAGG + Intronic
1085373188 11:76031067-76031089 CAGTTTTTGCAAATTCTATTAGG + Intronic
1086107566 11:83162561-83162583 CAGTATGTTCAAATTCACTTGGG + Intronic
1087265940 11:96061173-96061195 CCTTATGTGAATATTTTCTTGGG - Intronic
1088545697 11:110956581-110956603 CAGTGTGTACATATCCTCTTTGG + Intergenic
1088910108 11:114184342-114184364 CAGTATGTGCTGATTCTCCAAGG + Intronic
1092073454 12:5652954-5652976 CAGTATCTACAGATTCTCCTAGG + Intronic
1092931826 12:13322814-13322836 CAGGATTTCCATATTCTCTCCGG - Intergenic
1093263835 12:16975005-16975027 AAGTATTTTCTTATTCTCTTGGG + Intergenic
1093625575 12:21343185-21343207 CATTAGGTTCATATTTTCTTGGG + Intronic
1093810553 12:23487333-23487355 GATTATGTGCACAATCTCTTGGG - Intergenic
1095197596 12:39339655-39339677 CAGGATTTGCACACTCTCTTTGG + Intronic
1095983965 12:47987590-47987612 CCGTAAGTGCAGCTTCTCTTTGG - Exonic
1097418296 12:59341548-59341570 CAGTTTGTCCATATTCCCTTGGG + Intergenic
1100509129 12:95251824-95251846 CAGTATGTCCAAATTCTTTAAGG - Intronic
1100751475 12:97702943-97702965 CAGTACATGCAAATCCTCTTGGG + Intergenic
1101545697 12:105710390-105710412 CAGTGTGTGCAAAGTCTCTGTGG - Intergenic
1102772408 12:115489656-115489678 AAGGATGTGCAAATTTTCTTGGG - Intergenic
1105353631 13:19638152-19638174 GAATATATGCATATTCTTTTAGG - Intronic
1105490745 13:20885297-20885319 CAGAATATACATATTATCTTTGG + Intronic
1106040833 13:26090936-26090958 AATTGTGTGCATATACTCTTAGG + Intergenic
1107365768 13:39673013-39673035 TGGTATTTGCATATTTTCTTTGG + Intronic
1108080890 13:46734306-46734328 CTGTAAGTGAATCTTCTCTTAGG + Intronic
1108535857 13:51377165-51377187 TTGTATTTGCATATTTTCTTTGG + Intronic
1111032519 13:82622623-82622645 TAGTTTGTGCAAATTCTCTTAGG + Intergenic
1113361641 13:109636981-109637003 CAGTGTGTGCATTTTAACTTTGG - Intergenic
1114941224 14:27612870-27612892 TACCATGTCCATATTCTCTTTGG - Intergenic
1115023222 14:28708442-28708464 CACTTTGTGCCCATTCTCTTAGG - Intergenic
1116708155 14:48330188-48330210 CAGTATGTGAATATATTCTTAGG - Intergenic
1118048872 14:62004612-62004634 TTATATGTTCATATTCTCTTAGG - Intronic
1119556186 14:75554787-75554809 CTGTCTGTGCAGATTCTTTTTGG + Intergenic
1120313035 14:82855460-82855482 CATGATGTGGATATTCTTTTAGG + Intergenic
1122052519 14:99069788-99069810 CAGTCAGTGTATATTTTCTTGGG - Intergenic
1122163001 14:99800264-99800286 GAGCAAGTGCATACTCTCTTTGG + Intronic
1124883633 15:33663902-33663924 GAATATGTGCCAATTCTCTTGGG + Intronic
1126544030 15:49853156-49853178 AAGTATGTACATAGTCTCCTGGG + Intergenic
1127175550 15:56351534-56351556 CAGTATCTGCATATTGTGTAAGG + Intronic
1127358897 15:58227633-58227655 CAATAGTTGCATATTCTCTAAGG + Intronic
1127543933 15:59971951-59971973 CAGTATGTGCATATATGTTTGGG + Intergenic
1127821559 15:62661349-62661371 CAGTCTATCTATATTCTCTTAGG - Intronic
1128223354 15:65983897-65983919 CAGTAAGTGCATGTGATCTTTGG + Intronic
1134816567 16:17210736-17210758 CAGCATGTGAATCCTCTCTTGGG - Intronic
1135676458 16:24418944-24418966 AATTATGTGCATGCTCTCTTAGG - Intergenic
1140644701 16:77016766-77016788 CAGTAAGTGAATATTCTTATGGG - Intergenic
1140921940 16:79546776-79546798 CTTTATGTGCCTTTTCTCTTTGG - Intergenic
1141612811 16:85192730-85192752 CAGGAGGGGGATATTCTCTTTGG + Intergenic
1143941130 17:10542311-10542333 CATTATGTGATTATCCTCTTTGG - Intronic
1146129969 17:30263860-30263882 CAGTTTGTTGCTATTCTCTTTGG - Intronic
1146508489 17:33425852-33425874 CAGGATGTGCATATTTTGCTAGG + Intronic
1146830011 17:36060460-36060482 TAGGATGTGGATATTCTTTTGGG + Intergenic
1149170590 17:53805964-53805986 GAGAATGTGCTTATTCTATTAGG + Intergenic
1149424285 17:56540073-56540095 CAGTATGTGCAAAGTCCCTGTGG + Intergenic
1153009421 18:524562-524584 CAGTTTGTGCAGATTATTTTTGG + Intergenic
1153595674 18:6722751-6722773 CAGAATTCGCATGTTCTCTTTGG + Intergenic
1155700747 18:28740254-28740276 CATTATTTACATATTGTCTTTGG - Intergenic
1155778741 18:29803097-29803119 TATTATGTGCATATTCACTGAGG - Intergenic
1162488129 19:10974616-10974638 CGGTTTGTGCATGTTTTCTTTGG + Intronic
1164955070 19:32375912-32375934 CAGCATGTGCTCATTCTTTTAGG - Intronic
1167241949 19:48349236-48349258 CAGCATGTGCAAAGTCTCTGTGG - Intronic
926477662 2:13347375-13347397 CAGTTTGCTAATATTCTCTTTGG - Intergenic
927002977 2:18818242-18818264 CAATATCAGCATTTTCTCTTTGG - Intergenic
932312774 2:70757196-70757218 CAGTACATGCATATTATTTTGGG + Intronic
933189830 2:79322246-79322268 CAGTAAATGAATAGTCTCTTAGG + Intronic
935046438 2:99487883-99487905 CAGTAAATACATATTCCCTTTGG - Intronic
935497410 2:103797937-103797959 TGGTATTGGCATATTCTCTTGGG - Intergenic
937697163 2:124820707-124820729 CATTATGCGCATTATCTCTTTGG + Intronic
939294797 2:140246887-140246909 CAGTGTGTACATTTTCTTTTAGG - Intronic
939826036 2:147016789-147016811 CATTTTGTTCATATTCTATTGGG - Intergenic
940333948 2:152504714-152504736 CCGTATGTACATAATTTCTTAGG - Intronic
944008892 2:194946842-194946864 CAGTGTGTGCATATTGCCTTAGG - Intergenic
944474435 2:200089251-200089273 CATTATGTGCATCCTCTCCTGGG + Intergenic
944501802 2:200368978-200369000 CAGAATGTGTACATTATCTTTGG - Intronic
945012182 2:205477286-205477308 AACTCTGTGAATATTCTCTTTGG + Intronic
945189517 2:207172266-207172288 CTGTTTGTTCAGATTCTCTTTGG - Intergenic
945624034 2:212178027-212178049 CAGTATGTGCAAATGGTCTGTGG + Intronic
947269828 2:228321492-228321514 CAGGAGTTGTATATTCTCTTGGG + Intergenic
948157742 2:235797923-235797945 CACTATTTGCATATTGTCTTTGG - Intronic
948611245 2:239168572-239168594 CAGCATCTGTTTATTCTCTTGGG - Intronic
1174803324 20:53583675-53583697 CTGTATGTGCAAAATCTCTAAGG - Intronic
1175166614 20:57048628-57048650 CAGTATGTGCCTATTTCTTTAGG - Intergenic
1175678663 20:60968566-60968588 CATTATTGGCATCTTCTCTTGGG - Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1177280119 21:18971059-18971081 AAGTATGGTCATATTATCTTAGG - Intergenic
1178934764 21:36851784-36851806 CAGTATGTGTATATTTTATGGGG - Intronic
1180561346 22:16616954-16616976 CTGTATGTGCAAAATCTCTAAGG + Intergenic
1182005856 22:26959034-26959056 CAGTATCTGGATTTTCTCATTGG + Intergenic
1183534310 22:38388048-38388070 CTGTATGTGCAAAATCTCTAAGG - Intronic
951329417 3:21347991-21348013 CAGTTTGTTCAGATTCTTTTTGG - Intergenic
951365170 3:21772439-21772461 CACCATTTGCATATTATCTTTGG - Intronic
951785992 3:26419695-26419717 CAGAATCTAAATATTCTCTTAGG - Intergenic
952688601 3:36177204-36177226 CAGTATGTGAAAATTCAATTTGG - Intergenic
952746200 3:36783446-36783468 CATAATGTTTATATTCTCTTTGG - Intergenic
954374509 3:50187027-50187049 CAGTATGTGGAAATTCTATGGGG + Intronic
957279288 3:78128884-78128906 CAGTATATGTATATTCTTATTGG + Intergenic
957748647 3:84379592-84379614 CATTTTGTCCATATTATCTTAGG - Intergenic
960350753 3:116589688-116589710 CTGTATGTACATATTATCTTAGG - Intronic
962718074 3:138145238-138145260 CACTATCTGCATATTTTCTTTGG - Intergenic
962749654 3:138424521-138424543 CAGCATGTGCATATTTCCTGTGG + Intergenic
964108769 3:153067503-153067525 CTTTCTGTGCCTATTCTCTTTGG - Intergenic
964776797 3:160287970-160287992 CTGTCTGTCCCTATTCTCTTAGG - Intronic
964905058 3:161709239-161709261 CAGTATGTGCCTTTTATTTTGGG - Intergenic
964944857 3:162208599-162208621 AAGTATGTGCTCATTCTCTCAGG + Intergenic
966087610 3:176088179-176088201 GAGTATGTGCAGCTTCTCTAGGG + Intergenic
966485689 3:180467061-180467083 CAGTATGTAATTATTATCTTGGG - Intergenic
967004516 3:185371404-185371426 CAGTTACTGCACATTCTCTTAGG - Intronic
967612321 3:191521893-191521915 TAGTTTCTGCATATTCTCTTGGG - Intergenic
971262402 4:25069266-25069288 CAGTGGCTGCATATTCTCTGTGG - Intergenic
972056954 4:34815267-34815289 CACTATGTACATATTTCCTTTGG - Intergenic
976369145 4:84267042-84267064 CAGGATGTGCAAATGCTCTGTGG + Intergenic
977911646 4:102544114-102544136 ATGTATGTGCATTTTTTCTTGGG + Intronic
979822918 4:125196234-125196256 GGGGATGTGCCTATTCTCTTTGG - Intergenic
981666691 4:147235505-147235527 CAGTATGTACCTATTTTCATTGG - Intergenic
982388870 4:154842226-154842248 GAGTATTTGCATATCATCTTTGG - Intergenic
982703860 4:158686508-158686530 CTGTCTGTTCACATTCTCTTTGG + Intronic
983669394 4:170217843-170217865 CATTATTTGCATATGTTCTTTGG - Intergenic
983758770 4:171378127-171378149 CAGTATGTGAATTTTTCCTTTGG + Intergenic
983922095 4:173357184-173357206 CAGAATGTGGTTATCCTCTTTGG - Intergenic
984217085 4:176926936-176926958 CAGAAAGTGCATGCTCTCTTCGG - Intergenic
984716655 4:182931943-182931965 AAATCTGTGAATATTCTCTTTGG - Intergenic
986528213 5:8703830-8703852 AATTGTGTGCATATTCTCTTTGG + Intergenic
986830334 5:11570001-11570023 TAGTATGTGCATCTTGTCTTAGG - Intronic
987292480 5:16521908-16521930 CATTATTTCCATATTCGCTTTGG + Intronic
988263502 5:28921795-28921817 CAGCCTGTGCATATTCTGTGAGG - Intergenic
988706862 5:33735213-33735235 CAGTATCTGCATTTTAACTTTGG - Intronic
993379695 5:87192211-87192233 GAATATGTGGATATTCTGTTTGG - Intergenic
993881433 5:93366448-93366470 CAGAATGGACTTATTCTCTTCGG - Intergenic
993969992 5:94407583-94407605 CAGTATGTGCATTTTGTGTCCGG - Intronic
996148535 5:120006170-120006192 GTGTATGTGAATATCCTCTTTGG + Intergenic
997251358 5:132391140-132391162 CAGTATGAGCACATTAACTTGGG - Intronic
997689326 5:135815033-135815055 AATTATGTGCATTTCCTCTTGGG + Intergenic
998389337 5:141777322-141777344 CAGTATGTGCAAATGCCCTGTGG + Intergenic
998452166 5:142243319-142243341 CTGTATCTGCATATTATTTTGGG + Intergenic
999591071 5:153147045-153147067 CAGTTTGTGTATATTTTATTGGG - Intergenic
1001005176 5:168043498-168043520 AAGTATGTGCTAATTCTCTCTGG + Intronic
1002063542 5:176640840-176640862 CAGTATGTGCAAATGCCCTGGGG - Intronic
1003997085 6:11552800-11552822 CAGTCTGTGCACAGTCTCTATGG + Intronic
1004491478 6:16120911-16120933 AAGTAGGTGCCTATTCCCTTAGG + Intergenic
1005565065 6:27083375-27083397 CTATATGTGCATTTTCTTTTGGG + Intergenic
1009888330 6:69651606-69651628 GACTATGTGCATGTTCTTTTTGG - Intergenic
1012643574 6:101652647-101652669 CAGTATGTTTATATTCTGCTGGG + Intronic
1013256751 6:108395139-108395161 AAGTATTTGCATAAGCTCTTTGG - Intronic
1013997788 6:116328405-116328427 CAATATGTGCACAGTCTCCTCGG - Intronic
1018879005 6:167856466-167856488 CTTTATGTGCACATACTCTTAGG + Intronic
1019007015 6:168806823-168806845 GAGCATTTGCATATTTTCTTTGG + Intergenic
1021761755 7:23909111-23909133 CATTCTGTGCATGATCTCTTAGG - Intergenic
1022179568 7:27905604-27905626 CAGTAAATTTATATTCTCTTTGG + Intronic
1023912020 7:44563052-44563074 CAGCATGTGCAAATTCCCTGGGG - Intergenic
1024172191 7:46801352-46801374 CAAAATGTTCATATTGTCTTTGG + Intergenic
1024403546 7:48951558-48951580 AAATATGTGCATATTCTGTGGGG - Intergenic
1024959920 7:54963282-54963304 CAGGGTGTTCATATTGTCTTTGG + Intergenic
1027936981 7:84618901-84618923 CAGTGTGTGTGTATTCTCTTTGG + Intergenic
1030913707 7:115285471-115285493 CAGCAAGTTCATATTCTCTAAGG + Intergenic
1038108639 8:24467687-24467709 AGGTATGTACATATTCTCTGAGG - Intronic
1039122572 8:34164326-34164348 CAGTATGTGAATAACTTCTTTGG - Intergenic
1040465708 8:47693076-47693098 CAGTTTGTTCATGATCTCTTGGG + Intronic
1042408220 8:68430759-68430781 CTGTAGCTGAATATTCTCTTGGG + Intronic
1043465679 8:80504641-80504663 CAGTATGTGCATATTCTCTTAGG - Intronic
1046494090 8:114991235-114991257 AATTATATGAATATTCTCTTTGG - Intergenic
1047551858 8:125882532-125882554 CTGTAAGTGCATATTATTTTGGG + Intergenic
1051540439 9:18210148-18210170 ATGTATGTGCTCATTCTCTTGGG - Intergenic
1051747007 9:20304624-20304646 CAGTATATGCTTATTCTTATAGG + Intergenic
1052735667 9:32339883-32339905 CAGTATGTGCTTTTTCTGTTTGG - Intergenic
1056952432 9:91053407-91053429 CACTATTTGTATATTTTCTTTGG - Intergenic
1057375495 9:94518119-94518141 CACTATTTGTATATCCTCTTTGG + Intergenic
1059026860 9:110643970-110643992 CAGAATGTTCATATTTTATTAGG + Intergenic
1060562050 9:124553836-124553858 CAGTTTGTTCATATTATCTCAGG + Intronic
1187102675 X:16210909-16210931 CATTATGTTGATATTCTTTTAGG - Intergenic
1189523724 X:41798132-41798154 ATGTATGTGGATATTGTCTTTGG + Intronic
1189846435 X:45142838-45142860 TAGCATGGGCATATTCACTTGGG + Intergenic
1189929371 X:45991848-45991870 CAGTATGTGTATATACTTATGGG + Intergenic
1190171997 X:48118996-48119018 CAGTAGGTGTATATTCTTATGGG - Intergenic
1190199501 X:48348122-48348144 CAGTAGGTGTATATTCTTATGGG + Intronic
1190210239 X:48440985-48441007 CAGTAGGTGTATATTCTTATGGG - Intergenic
1193195727 X:78629486-78629508 CAGTATGTGTTTGTTCTCATTGG + Intergenic
1193850708 X:86533982-86534004 GAGTATGTGCAGAAACTCTTAGG - Intronic
1194187226 X:90787452-90787474 CAGAATGTGCTTCTACTCTTAGG + Intergenic
1195140329 X:101952258-101952280 CAGTTTCTTCATATTGTCTTTGG - Intergenic
1195991110 X:110683419-110683441 CAGGATGGGAACATTCTCTTGGG - Intronic
1198491253 X:137144086-137144108 CAGAATGTGCATTGTCTCCTTGG - Intergenic
1198597750 X:138255375-138255397 CAGTTTGTTCAGATTCTCCTCGG - Intergenic
1198979328 X:142377136-142377158 CAGTATGTGCAGAGGCTCTGGGG + Intergenic
1200312993 X:155098751-155098773 AAGTATGTATATTTTCTCTTGGG + Intronic
1200533821 Y:4369488-4369510 CAGAATGTGCTTCTACTCTTAGG + Intergenic
1202018601 Y:20438800-20438822 CTGTATCAGCAAATTCTCTTCGG - Intergenic