ID: 1043473714

View in Genome Browser
Species Human (GRCh38)
Location 8:80585785-80585807
Sequence CTCCTTAAGTTGAAAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043473714_1043473717 25 Left 1043473714 8:80585785-80585807 CCTTTTTTTTTCAACTTAAGGAG No data
Right 1043473717 8:80585833-80585855 GCTTCTTTTGTTGAGGAAATAGG No data
1043473714_1043473716 18 Left 1043473714 8:80585785-80585807 CCTTTTTTTTTCAACTTAAGGAG No data
Right 1043473716 8:80585826-80585848 TTCTGTTGCTTCTTTTGTTGAGG No data
1043473714_1043473718 28 Left 1043473714 8:80585785-80585807 CCTTTTTTTTTCAACTTAAGGAG No data
Right 1043473718 8:80585836-80585858 TCTTTTGTTGAGGAAATAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043473714 Original CRISPR CTCCTTAAGTTGAAAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr