ID: 1043476481

View in Genome Browser
Species Human (GRCh38)
Location 8:80610679-80610701
Sequence TGCAGCTGGTCCGCAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043476475_1043476481 14 Left 1043476475 8:80610642-80610664 CCGTACATTTTCATTGTGTACTG No data
Right 1043476481 8:80610679-80610701 TGCAGCTGGTCCGCAGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043476481 Original CRISPR TGCAGCTGGTCCGCAGATTA TGG Intergenic
No off target data available for this crispr