ID: 1043476790

View in Genome Browser
Species Human (GRCh38)
Location 8:80613121-80613143
Sequence ATATGGGATGTGGCCAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043476790_1043476794 11 Left 1043476790 8:80613121-80613143 CCAAATTTGGCCACATCCCATAT No data
Right 1043476794 8:80613155-80613177 CTCAGAGCCAGAGCCAACTGTGG No data
1043476790_1043476795 12 Left 1043476790 8:80613121-80613143 CCAAATTTGGCCACATCCCATAT No data
Right 1043476795 8:80613156-80613178 TCAGAGCCAGAGCCAACTGTGGG No data
1043476790_1043476797 23 Left 1043476790 8:80613121-80613143 CCAAATTTGGCCACATCCCATAT No data
Right 1043476797 8:80613167-80613189 GCCAACTGTGGGTTTGCCTGAGG No data
1043476790_1043476799 26 Left 1043476790 8:80613121-80613143 CCAAATTTGGCCACATCCCATAT No data
Right 1043476799 8:80613170-80613192 AACTGTGGGTTTGCCTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043476790 Original CRISPR ATATGGGATGTGGCCAAATT TGG (reversed) Intergenic
No off target data available for this crispr