ID: 1043483251

View in Genome Browser
Species Human (GRCh38)
Location 8:80673979-80674001
Sequence CAGGTAGAACATCATGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043483251_1043483254 -6 Left 1043483251 8:80673979-80674001 CCAGCTCCATGATGTTCTACCTG 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1043483254 8:80673996-80674018 TACCTGCAGTGTGCAGTGCTGGG No data
1043483251_1043483256 0 Left 1043483251 8:80673979-80674001 CCAGCTCCATGATGTTCTACCTG 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1043483256 8:80674002-80674024 CAGTGTGCAGTGCTGGGCGTAGG No data
1043483251_1043483253 -7 Left 1043483251 8:80673979-80674001 CCAGCTCCATGATGTTCTACCTG 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1043483253 8:80673995-80674017 CTACCTGCAGTGTGCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043483251 Original CRISPR CAGGTAGAACATCATGGAGC TGG (reversed) Intronic
901207062 1:7503431-7503453 CAGGTAGAGGACCATGGAGTTGG + Intronic
901408810 1:9068390-9068412 CAGCTAGAATAGGATGGAGCAGG + Intronic
902700847 1:18170892-18170914 CAGGAAGGGCTTCATGGAGCAGG + Intronic
903468601 1:23569050-23569072 CAGCTAGACCAGGATGGAGCAGG + Intergenic
904829324 1:33296535-33296557 CAGGGAGGACACAATGGAGCTGG + Intronic
910106588 1:83637839-83637861 CAGGTAGTAAATCATTGAGTTGG - Intergenic
910191130 1:84596987-84597009 ATGGTAGAACATCAAGGATCAGG - Intergenic
913246605 1:116875561-116875583 CCGGCAGAACGTCATGGAGTTGG - Intergenic
918951240 1:191142442-191142464 AAGGTAGAAGATCATGAAACAGG - Intergenic
920807139 1:209245616-209245638 ATGGTGGAACATCACGGAGCTGG + Intergenic
921806549 1:219461913-219461935 CAAGGAGAACCTCATGGAGGTGG - Intergenic
922490488 1:226012534-226012556 AAGGTAGAAGATCAGGGAGGAGG + Intergenic
924424491 1:243938849-243938871 CAGGTTAAACATCCTGGAACAGG - Intergenic
1063874991 10:10465888-10465910 AAGGTATAAAATCATGGGGCAGG - Intergenic
1066405899 10:35117992-35118014 CAAGTAGAACATGCTGGTGCAGG - Intergenic
1066461912 10:35619756-35619778 CAAGTAGAACACCCTGGAGGAGG + Intergenic
1070064143 10:73016880-73016902 CAGGTAGCAAATTATGGAGTTGG - Exonic
1070918795 10:80171213-80171235 CAAGTTCACCATCATGGAGCAGG + Intronic
1070947175 10:80402281-80402303 CAGCTAGAACATAGTGGAGATGG - Intergenic
1071349314 10:84723643-84723665 CAGGTAAAACAACTTGGGGCGGG + Intergenic
1071729661 10:88234842-88234864 CAGGAAGGACTTCATGGAGGAGG + Intergenic
1073563069 10:104513421-104513443 CAGGTAGAGCCTCTTGAAGCTGG + Intergenic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1076109536 10:127850255-127850277 CAGGAAGAATCTCATGAAGCTGG - Intergenic
1078348746 11:10574843-10574865 CCGGTAGTAAATCATGGGGCTGG - Exonic
1084106804 11:66985820-66985842 CAGGGAGAACATCCTGGAACTGG - Intergenic
1084710778 11:70842654-70842676 CAGGTGGCACAGCAGGGAGCAGG - Intronic
1086010337 11:82095369-82095391 TAGGTAGAACATCATGAGCCTGG + Intergenic
1086606434 11:88701701-88701723 AAGGTAGAACATCTTGAAGCAGG + Intronic
1087905769 11:103695154-103695176 CCCTTACAACATCATGGAGCTGG - Intergenic
1089151473 11:116367629-116367651 CAGCTAGAAAACGATGGAGCTGG - Intergenic
1091032845 11:132206604-132206626 CAGTTAGAACATAGTAGAGCCGG + Intronic
1091047252 11:132335498-132335520 CACGTGGAACATTCTGGAGCTGG + Exonic
1091191277 11:133697513-133697535 CAGGCAGAACAGAATGCAGCCGG + Intergenic
1096259186 12:50080495-50080517 CAGGGAGAACATCCTGGTGCTGG + Exonic
1098389666 12:69956220-69956242 CAGGTAGTAAGTGATGGAGCTGG + Intronic
1099015583 12:77339932-77339954 CATGTAGAGCATGATGAAGCTGG + Intergenic
1099240503 12:80132848-80132870 CAGGTTGAACATTATGAAGGTGG + Intergenic
1100122240 12:91382300-91382322 CAGGTAGAACAAAAGGGAGTGGG + Intergenic
1100405963 12:94273030-94273052 CATGTCCAAAATCATGGAGCCGG - Intronic
1100736901 12:97545341-97545363 TAGAGGGAACATCATGGAGCTGG + Intergenic
1103035985 12:117656706-117656728 CAGGTAGAAAAACATGGAAAAGG + Intronic
1103727524 12:123005456-123005478 CATGGAGAACATCCGGGAGCTGG - Exonic
1105682100 13:22738906-22738928 CAGGAAGAAGATCAGGGATCTGG - Intergenic
1106690287 13:32107771-32107793 CAGGGAGGCCTTCATGGAGCAGG + Intronic
1108041332 13:46341822-46341844 CAGGAAGTGCATGATGGAGCTGG - Intergenic
1110794854 13:79624328-79624350 CATGGTGAACATCATGGGGCAGG + Intergenic
1112010413 13:95289405-95289427 CAGGCAGGACATGATGGAGTTGG - Intronic
1112848338 13:103672071-103672093 AAGAGAGAACATGATGGAGCTGG - Intergenic
1113340888 13:109424704-109424726 CAGCTAGTAAATGATGGAGCTGG + Intergenic
1115745295 14:36430340-36430362 CAGGAAGAATAGCATGGAGATGG + Intergenic
1117205698 14:53441123-53441145 CATGTAGGACACCAAGGAGCAGG - Intergenic
1117378577 14:55138041-55138063 CAGATAACGCATCATGGAGCTGG - Exonic
1118434829 14:65761007-65761029 CAGCCAAAACATCATGGTGCTGG - Intergenic
1118774203 14:68963184-68963206 CAGGTAGGACTTCCTGGAGGAGG - Intronic
1119807173 14:77489761-77489783 CAGGTTGCACACCATGAAGCCGG - Intronic
1121417920 14:93791674-93791696 CAGGTTGTACATTATTGAGCTGG - Intergenic
1125250679 15:37699064-37699086 CATATAGGACATCATGGAGAGGG + Intergenic
1126062602 15:44798047-44798069 CAGATAGAAAATAATGGAGTAGG - Intergenic
1128186361 15:65646375-65646397 GAGGTAGAAAAACATGGAGACGG - Intronic
1129691120 15:77714195-77714217 CAGGGAGAAGGTCATGGAGAAGG - Intronic
1134443955 16:14316594-14316616 CAGTTAGAACATCATGAACTTGG + Intergenic
1134556049 16:15166178-15166200 CAGCTAGCAAATAATGGAGCTGG + Intergenic
1134916633 16:18077913-18077935 CAGCTAGCAAATAATGGAGCTGG + Intergenic
1135064938 16:19301468-19301490 CAGGTAGGAAGTGATGGAGCTGG - Intronic
1135851107 16:25964592-25964614 CAGCTAGGAAATGATGGAGCTGG + Intronic
1135936799 16:26787391-26787413 CAGCTAGTACATGATGGAGCAGG - Intergenic
1139272893 16:65700053-65700075 CAGGGAGAACATGAGTGAGCTGG - Intergenic
1139911165 16:70398516-70398538 CAGGGAGCACTTCATGGTGCCGG + Exonic
1140738549 16:77921166-77921188 CAGGAATAGCATCATGGGGCTGG + Intronic
1141015051 16:80441254-80441276 CAGGTGAAACAACATGGAGTTGG - Intergenic
1142191418 16:88719948-88719970 CTGGTTGAACATCCTGGGGCGGG + Exonic
1145202313 17:20957265-20957287 CAGGTAGAAAAACATCTAGCAGG - Intergenic
1145911605 17:28546517-28546539 CATTTAGAACATGATGGAGCTGG - Intronic
1149375632 17:56041432-56041454 GAGGTAATACATGATGGAGCTGG - Intergenic
1149615038 17:57989769-57989791 CAGGTAACACATCAGGGAACCGG + Exonic
1149858734 17:60108169-60108191 GAGGGAGAACAACTTGGAGCTGG - Intergenic
1151496630 17:74461953-74461975 CAGGGATAGCATCATGGATCAGG - Intergenic
1155073676 18:22337393-22337415 GAGGAAGGACATCATGGAGAAGG + Intergenic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1156159822 18:34346217-34346239 CAGGTACAACAACTTGGAGTTGG - Intergenic
1156729272 18:40170860-40170882 CATGTTGGACATCATGGGGCTGG - Intergenic
1159047304 18:63381560-63381582 CAGGCAGAACTCCATGGAGAGGG - Intergenic
1159078449 18:63708033-63708055 CAGGAAGAACTTCATGGAAGAGG + Intronic
1159530405 18:69648649-69648671 TAGGTAGAACATCATTGCCCTGG + Intronic
1161085702 19:2333989-2334011 CTGGTAGAACAGCAGGAAGCAGG - Intronic
1162699065 19:12500150-12500172 AAGGTAGAATATCTTGAAGCGGG + Intronic
1162772096 19:12955373-12955395 CAGGCAGGGAATCATGGAGCAGG - Intronic
1164547562 19:29181684-29181706 CAGATAGAAAATAGTGGAGCTGG + Intergenic
1165431758 19:35776890-35776912 CAGGGAGAACTTCCTGGAGGAGG + Intronic
1167670899 19:50852749-50852771 CAGTGAGAACCTCATGGATCCGG - Intergenic
926189770 2:10720289-10720311 CAGGGAAAACATCTTAGAGCTGG - Intergenic
926211077 2:10869837-10869859 CAGGTAGAACAAAATTGAGATGG + Intergenic
930191735 2:48466731-48466753 CATGAACAAAATCATGGAGCAGG + Intronic
931158795 2:59665439-59665461 CAGGTAGAAGATGAAGGAGGAGG + Intergenic
933199688 2:79434853-79434875 TAGGCAGACCAACATGGAGCAGG + Intronic
935276404 2:101479409-101479431 CATGCAGAACAGCAGGGAGCAGG - Intergenic
936860556 2:117013061-117013083 AAGGCAGGACATCTTGGAGCAGG + Intergenic
937079936 2:119133609-119133631 CTGATAGAACAAAATGGAGCTGG - Intergenic
938252239 2:129824536-129824558 CAACTAGAACATCAAGTAGCTGG + Intergenic
940805993 2:158187057-158187079 CAAGGAGAACATCAAGCAGCTGG - Intronic
941866681 2:170342788-170342810 CAGCTAGTACATGGTGGAGCTGG + Intronic
945070979 2:205988680-205988702 CAGCTAGCAAATTATGGAGCTGG - Intergenic
946834274 2:223756931-223756953 CAGGTAAAACATCAAATAGCAGG + Intronic
946920631 2:224577592-224577614 CAGCTAGAAAGACATGGAGCTGG + Intronic
947740992 2:232484923-232484945 GAGGGAGGGCATCATGGAGCAGG - Intronic
1172250210 20:33474134-33474156 CAGGGAGAGCTTCCTGGAGCAGG - Intergenic
1172974396 20:38895421-38895443 CAGTGTGAACATCATGGAGCTGG + Intronic
1173842056 20:46163941-46163963 CACGGAGAACATGATGGAGATGG - Intergenic
1174578406 20:51553803-51553825 AAGGTAGAACCTCAAGGGGCAGG + Intronic
1174734941 20:52956831-52956853 CATGAAGAACATTATGGAACAGG + Intergenic
1177739790 21:25140262-25140284 CTCGTACAACATAATGGAGCAGG + Intergenic
1178263032 21:31117247-31117269 CTGGAATAACTTCATGGAGCAGG + Intergenic
1178266868 21:31151528-31151550 CAGGGAGCAGAGCATGGAGCAGG + Intronic
1179835601 21:44030123-44030145 CAGGGAGAAGAGCTTGGAGCAGG + Intronic
1180676693 22:17591393-17591415 CAGCTAGTACATGGTGGAGCTGG - Intergenic
1180973955 22:19834542-19834564 CAGTTATAACATAATGGAGGAGG + Intronic
1181907247 22:26209216-26209238 CATCTAGATCATCATGGAGTGGG + Intronic
1183257580 22:36772296-36772318 CAGCTAGAAAGTGATGGAGCTGG - Intronic
1184759051 22:46534620-46534642 CATGTACACCATGATGGAGCTGG - Exonic
949179407 3:1110341-1110363 CAGGTATACCATCATGGGGAAGG + Intronic
950215757 3:11157386-11157408 CAGATAAAACATCTTGGATCAGG - Intronic
950708739 3:14800394-14800416 CAGGTAGAACAGGATGAATCTGG + Intergenic
951847751 3:27102576-27102598 CAAGTAGAATATCATGGAGCTGG + Intergenic
952344795 3:32473299-32473321 CATGTAGAGCACCATGGGGCAGG + Intronic
952805699 3:37349359-37349381 CAAGGAGAACATCATGGAGGAGG + Intronic
954647631 3:52141228-52141250 CAGGCAGAGCAGCATGGAGTGGG - Intronic
958818534 3:98946311-98946333 GGGGTAGAACAACATGGAACAGG + Intergenic
960785166 3:121364167-121364189 CAGGTAAAACTTGATGGTGCAGG - Intronic
962949387 3:140204091-140204113 CAGGTAGAAAATGGTGAAGCAGG - Intronic
964521894 3:157579214-157579236 CAGCTAGAATATAATGTAGCAGG + Intronic
964555724 3:157936083-157936105 GAGGTATAACATCATGTGGCGGG - Intergenic
964934043 3:162059729-162059751 CAGGTGGAGCATCTGGGAGCTGG + Intergenic
966594329 3:181712360-181712382 CATGTACAACATGATGGAGACGG + Exonic
969305957 4:6326453-6326475 CAAGGAGAACTTCATGGAGGAGG + Intronic
969550139 4:7860444-7860466 CAGGTTGAACATCCTGAATCTGG - Intronic
970278844 4:14431989-14432011 CAGGGAGGACATCGTGGTGCAGG - Intergenic
971452200 4:26810602-26810624 CACGGAGAACAGCATGGCGCAGG - Intergenic
972741259 4:41888813-41888835 CAGCTAGAAAATGATAGAGCTGG + Intergenic
976011462 4:80494110-80494132 CAGGAAGAAGAGCATGGAGGTGG - Intronic
977683986 4:99826817-99826839 CAGGGAAAACTTCATGGAGCGGG - Intronic
978887906 4:113787461-113787483 CAGGTAGTATGTGATGGAGCTGG - Intergenic
979289618 4:118965421-118965443 CAGCAAGAGCATCCTGGAGCTGG - Intronic
980829711 4:138115246-138115268 CAGGTAGAAAATCAGGGCCCTGG + Intergenic
984666648 4:182436300-182436322 CTGGGAGAACATCATGGAAGGGG + Intronic
985352679 4:189083014-189083036 CAGCTAGAAAATCAGGGAGAAGG + Intergenic
985363541 4:189201572-189201594 GAGGGAGAATATGATGGAGCAGG + Intergenic
985934175 5:3081817-3081839 CAGGTGGAATATCATGGATGGGG - Intergenic
986296817 5:6446314-6446336 CAGGTAGAGAAGCACGGAGCTGG + Intergenic
988470032 5:31529050-31529072 CAGGCGGAACATCATGATGCAGG - Exonic
994661835 5:102663085-102663107 GAGGTAAAAGATCATGGAGAAGG - Intergenic
997435259 5:133869513-133869535 CAGATTGAACATCTCGGAGCAGG - Intergenic
997709958 5:135996031-135996053 CAGGTACTCCATCATGGAGAAGG - Intergenic
997736344 5:136215369-136215391 CAGGCAGAACATCAGGGATCAGG - Intronic
998671096 5:144355107-144355129 CATCTAGAACATTCTGGAGCTGG + Intronic
1001850169 5:174956865-174956887 CAGCTAGAAAATGGTGGAGCTGG + Intergenic
1002577689 5:180184989-180185011 CAGATAGAAAATCATGAAGGAGG + Intronic
1003459942 6:6320263-6320285 CAGGGAGCAGATTATGGAGCTGG - Intronic
1003568643 6:7241423-7241445 CAGGGACAGCATCATGGTGCTGG + Intronic
1003955059 6:11155262-11155284 CAGGTAGAAAATCATGAACTAGG + Intergenic
1004322964 6:14647433-14647455 CAGCTGCTACATCATGGAGCTGG + Intergenic
1011055317 6:83197778-83197800 CAGAGAGGACATGATGGAGCAGG + Exonic
1011903538 6:92332118-92332140 CAGGGAGAACATCATGGATAGGG + Intergenic
1012526884 6:100188392-100188414 CATATAGAACATCATGTAGATGG - Intergenic
1014992292 6:128095710-128095732 CAGATAGAACATTAAGAAGCTGG + Intronic
1015349756 6:132203790-132203812 CTGGTAGAACTTGATAGAGCTGG - Intergenic
1017009571 6:150054160-150054182 CAGGTTGAGGGTCATGGAGCTGG - Intergenic
1017015196 6:150094273-150094295 CATGTAGAACCTCATGTATCTGG - Intergenic
1019104789 6:169659537-169659559 CAGGAAGAACATGATGGGGAGGG + Intronic
1019797071 7:3058279-3058301 TAGGCAAACCATCATGGAGCCGG + Intergenic
1019909645 7:4092069-4092091 CAGCTAGAAAGTGATGGAGCTGG - Intronic
1022443666 7:30452918-30452940 CATGGACACCATCATGGAGCTGG - Exonic
1023733061 7:43210350-43210372 CTGGTAGAACATCATTAAGAGGG + Intronic
1023895705 7:44431277-44431299 CAGGTTGAAGATTATGGAGTAGG + Intronic
1024059121 7:45685329-45685351 CAGGAGGAACAGGATGGAGCTGG + Intronic
1024059131 7:45685378-45685400 CAGGAGGAACAGGATGGAGCTGG + Intronic
1024059187 7:45685639-45685661 CAGGAGGAACAGGATGGAGCTGG + Intronic
1025233534 7:57218675-57218697 CAGGTTGAGGGTCATGGAGCTGG + Intergenic
1029139206 7:98398281-98398303 CAGCTTGAACATCATGGGGCAGG + Intronic
1029364279 7:100107235-100107257 CAGGTGGAGCATCACGGAGCAGG + Exonic
1040010579 8:42657992-42658014 AAGGTAGGACATCTTGAAGCAGG + Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041677597 8:60551062-60551084 CAGGTAGTCCCTCATGGAGAAGG - Intronic
1043113808 8:76222038-76222060 CAGTTCAAACATCCTGGAGCTGG - Intergenic
1043483251 8:80673979-80674001 CAGGTAGAACATCATGGAGCTGG - Intronic
1044014582 8:87035782-87035804 CATGGAGAACTCCATGGAGCCGG - Intronic
1044084740 8:87930532-87930554 GATGTAGAACATGATGGAGGTGG - Intergenic
1044720479 8:95140716-95140738 CAGGTAGAACATCTAGGAACAGG - Intronic
1046575821 8:116027506-116027528 CAGGTGAAACATCTTTGAGCTGG + Intergenic
1048925719 8:139269387-139269409 CCAGGAGAGCATCATGGAGCTGG + Intergenic
1049306468 8:141906837-141906859 CTGGAAGGACCTCATGGAGCAGG - Intergenic
1050003266 9:1101011-1101033 CAGCAAAAACATCATGGGGCAGG - Intergenic
1051018588 9:12512816-12512838 CAGTTAATACATGATGGAGCAGG + Intergenic
1051526721 9:18053169-18053191 CAGGTTGGACTTCATGGAGAAGG + Intergenic
1051680481 9:19602708-19602730 CAGGTAGAAACTGATGGAGCTGG - Intronic
1053375760 9:37605024-37605046 CAGATAGTACATTGTGGAGCTGG + Intronic
1054869342 9:70035064-70035086 CAGATAGGAGACCATGGAGCTGG + Intergenic
1192087874 X:68119250-68119272 GAGGTAGAATTTCAAGGAGCTGG + Exonic
1194764660 X:97835971-97835993 CAGGAAAGCCATCATGGAGCAGG - Intergenic
1195297110 X:103489956-103489978 CAGCTTGAACATCCGGGAGCAGG + Intergenic
1199253779 X:145695340-145695362 CAGGGAGAACATCCTGAAGGAGG - Intergenic