ID: 1043483844

View in Genome Browser
Species Human (GRCh38)
Location 8:80679410-80679432
Sequence TTGGACCCATGCAGCAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043483844_1043483853 25 Left 1043483844 8:80679410-80679432 CCCAGATTGCTGCATGGGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1043483853 8:80679458-80679480 CAAAGCTTCTGGCAGAGTTGCGG No data
1043483844_1043483850 14 Left 1043483844 8:80679410-80679432 CCCAGATTGCTGCATGGGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1043483850 8:80679447-80679469 GCCAAACCAAGCAAAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043483844 Original CRISPR TTGGACCCATGCAGCAATCT GGG (reversed) Intronic
902329009 1:15721441-15721463 TTTGATACATGCAGCAAGCTTGG - Intronic
904544843 1:31261298-31261320 TTGGAGCAATGGTGCAATCTTGG - Intronic
908619674 1:65963440-65963462 TTGCACCCCTGCAGCAAGGTTGG + Intronic
911478736 1:98409284-98409306 GTGGACCCAAGCAACAAACTGGG + Intergenic
912213887 1:107585299-107585321 TTAGGCCCATACAGCAATCAAGG - Intronic
913233703 1:116762877-116762899 TTGGGCACATGCAGGAATGTAGG - Intronic
914172217 1:145235214-145235236 TTGGACCCACGCAGTTGTCTTGG - Intergenic
915169211 1:153966156-153966178 TTGGAGCTCTGCATCAATCTAGG + Intronic
917160833 1:172055299-172055321 TTTGATCCATGCAGATATCTTGG - Intronic
1063290641 10:4743622-4743644 TTGGAACCTTGCATCTATCTTGG + Intergenic
1068472515 10:57483012-57483034 TAGGACCCCTGCAGCCTTCTAGG - Intergenic
1070679634 10:78439493-78439515 GTGGGCCCAGGCAGGAATCTGGG + Intergenic
1073750171 10:106516651-106516673 TGGGACCCATGCACAAAACTTGG - Intergenic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1076495579 10:130895483-130895505 TGGGACCCATGCAGCACACAAGG + Intergenic
1077251651 11:1563428-1563450 TGGGACCCAGGCAGCAGCCTTGG + Intronic
1082556253 11:54566243-54566265 TTGCTCCTATTCAGCAATCTTGG + Intergenic
1084573029 11:69970866-69970888 TTGAGCCCAAGCAGCCATCTTGG - Intergenic
1084861635 11:72022635-72022657 ATTGAGCCATGCAGGAATCTTGG - Intronic
1090240430 11:125177674-125177696 TGGGTCCCATGCAGCACTGTGGG - Intronic
1098812968 12:75119638-75119660 CTGGACCTATGCAGCTCTCTGGG - Intronic
1099415841 12:82385422-82385444 ATGAAACCATGCTGCAATCTAGG - Intronic
1101402430 12:104400246-104400268 CTGGAACCAGGCAGCCATCTTGG + Intergenic
1105399252 13:20073404-20073426 TTGGGCCCATGGAGCTAGCTAGG + Intronic
1109261005 13:60144969-60144991 AGGGACCCATTTAGCAATCTTGG - Intronic
1114970413 14:28019876-28019898 TTGGATTCATCCAGCACTCTAGG + Intergenic
1121662631 14:95646735-95646757 TTGGACCCAGGCATCAAACATGG - Intergenic
1122918457 14:104869535-104869557 CAGGACACATGCAGCAATATCGG - Intronic
1128647154 15:69386500-69386522 AAGGACCCCTGCATCAATCTTGG - Intronic
1130340266 15:82995232-82995254 TGGGACCCATGCAGCCAGCCTGG - Intronic
1130445533 15:83997894-83997916 TTGGTCCTTTGCAGGAATCTGGG + Intronic
1131427208 15:92355364-92355386 TTGTACCCATGGGGCAATTTTGG - Intergenic
1133711823 16:8408955-8408977 TTGGAACCATTCATAAATCTAGG - Intergenic
1141602832 16:85136831-85136853 TTGAGCTCATGCAGCAAGCTAGG - Intergenic
1141827351 16:86489965-86489987 TGGCTTCCATGCAGCAATCTGGG + Intergenic
1143974884 17:10822346-10822368 TTTCTCCCAGGCAGCAATCTGGG + Intergenic
1145208802 17:20998187-20998209 GTGGGCCCATCCAGCAATCATGG - Intergenic
1146728342 17:35173691-35173713 TTGGGCCCACACAGAAATCTAGG + Intronic
1148513835 17:48197358-48197380 TAGGGCTCATGCAGAAATCTTGG + Intronic
1148776446 17:50098254-50098276 TGGCACCCTTGCAGAAATCTTGG + Intronic
1148816061 17:50329094-50329116 CTGGAACCATGCAGCACTCGAGG + Intergenic
1151162569 17:72177477-72177499 TTAGACACATGCGGCATTCTGGG - Intergenic
1151559090 17:74861295-74861317 TTGGACCCACGCAGGACTCTCGG - Intronic
1151562078 17:74875814-74875836 TTGGATCCAGGCAGCCCTCTTGG - Intergenic
1153892282 18:9528832-9528854 TTGGACCCACAGACCAATCTGGG - Intronic
1155047597 18:22116571-22116593 TTAGAGCTATGAAGCAATCTAGG + Intergenic
1156212630 18:34962818-34962840 TTGGACCAATCCAGAAATGTGGG + Intergenic
1158259929 18:55595333-55595355 TGGGACCCATGCAGAAATAATGG - Intronic
1158260433 18:55600452-55600474 TTGGAACAATGAAGCACTCTAGG - Intronic
1168064745 19:53912730-53912752 TTGACCCCATGCAGCAACCCGGG - Intronic
927102130 2:19795969-19795991 TTGGACCCTGGCAGCAGTCAGGG - Intergenic
929124547 2:38511249-38511271 TTGGTTCCATGATGCAATCTGGG + Intergenic
941858599 2:170254876-170254898 CTGGAATCGTGCAGCAATCTGGG + Intronic
942895427 2:181047722-181047744 GTGGACCACTGCAGTAATCTGGG - Intronic
943664069 2:190590006-190590028 ATGGACCCAGGCAGCAATGATGG - Intergenic
1169045105 20:2528747-2528769 TTGGACCCATCCAGGTATCTGGG - Intergenic
1169413605 20:5396102-5396124 TTGGACCCAGGCAGCATTCTTGG - Intergenic
1174398869 20:50265029-50265051 TTGGACAAATACAGTAATCTGGG + Intergenic
1175071957 20:56342406-56342428 TTGGCTGCTTGCAGCAATCTTGG - Intergenic
1175645098 20:60664277-60664299 TGGGACCCATGCCCCATTCTGGG + Intergenic
1179076765 21:38129521-38129543 TTGGATACTTGCAGAAATCTTGG + Intronic
1179933910 21:44590768-44590790 GTGGACCCTGGCAGCACTCTGGG - Intronic
1179940983 21:44638771-44638793 GTGGACCCTGGCAGCACTCTGGG + Intronic
1184936026 22:47721749-47721771 TTGGATCCATGAATCAATTTAGG + Intergenic
949455338 3:4232224-4232246 TTAGAACCATGCAGCAACCAAGG + Intronic
950961130 3:17109172-17109194 AAGGAGCCATGTAGCAATCTGGG + Intergenic
963000912 3:140680670-140680692 CAGGACCCATGCAGGAATCTGGG + Intronic
964697329 3:159524442-159524464 TTGGAGCAATACAGGAATCTGGG - Intronic
964884400 3:161464682-161464704 TTGCAACCCTGCAGCCATCTGGG + Intergenic
968546158 4:1200071-1200093 TTGGACCCAGGCTCCAATCCCGG + Intronic
970587317 4:17526971-17526993 TTCGGCCCATGCTGCAAACTTGG + Exonic
972388668 4:38592167-38592189 TTGCATTCTTGCAGCAATCTCGG - Intergenic
973722756 4:53741875-53741897 TTTCCCCCATGCAGAAATCTGGG - Intronic
980121534 4:128732902-128732924 TTAGAACCCTGCAGCAGTCTTGG + Intergenic
989771855 5:45154924-45154946 TTGGACTCATGCAGCAAACCTGG - Intergenic
997983441 5:138485276-138485298 TTGGACCCATCAATCAATCTGGG - Intergenic
998882303 5:146656271-146656293 GGGGAGCCATGCAGCAATGTGGG + Intronic
999672682 5:153971543-153971565 ATGGACCCCTGAAGCTATCTTGG - Intergenic
1004638410 6:17490658-17490680 TTGGACCCATGCAGAATCTTAGG - Intronic
1005401488 6:25438921-25438943 TTGGACACTTGTAGTAATCTAGG + Intronic
1005905834 6:30260867-30260889 TTTGACCCCTGCAGCAGCCTGGG + Intergenic
1006052589 6:31355906-31355928 TTTGACCCCTGCAGCAGCCTTGG - Intronic
1006065884 6:31462481-31462503 TTTGACCCCTGCAGCAGTCTTGG - Intergenic
1018372966 6:163185801-163185823 CTGGACCCATGAGGCAGTCTGGG - Intronic
1020498210 7:8883565-8883587 TTGGACTCATGCAGTAATGTAGG - Intergenic
1020857045 7:13441135-13441157 ATGGACTCATGAAGCAACCTGGG - Intergenic
1021924314 7:25520088-25520110 TTGGAACCATCCAGCCATGTCGG + Intergenic
1023238669 7:38118278-38118300 TTGAACCAATCCTGCAATCTAGG - Intergenic
1025019670 7:55471139-55471161 TTGGACCCACGCAGTTGTCTTGG + Exonic
1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG + Intronic
1026635083 7:72075071-72075093 TTGGACTCAAGCTGAAATCTTGG - Intronic
1035271295 7:157721631-157721653 TTCCTCCCATGCAGCAAGCTCGG - Intronic
1043483844 8:80679410-80679432 TTGGACCCATGCAGCAATCTGGG - Intronic
1048432227 8:134381268-134381290 TTGAACCCAGGCAGCCATCCGGG + Intergenic
1050306514 9:4310942-4310964 TTGGACCCATTCTGCATTCAGGG + Intronic
1051232519 9:14967536-14967558 TTGTACACCTGCAGCAATATTGG + Intergenic
1059070759 9:111133544-111133566 TTGCCCCCAGGCAGCAATCCAGG - Intergenic
1061767707 9:132892297-132892319 TGGGATCTTTGCAGCAATCTGGG + Exonic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1187302642 X:18065872-18065894 TTGCACCCATCCAGAAACCTAGG + Intergenic
1189183907 X:39034894-39034916 CTGGCCCCATTTAGCAATCTTGG - Intergenic
1191951731 X:66600255-66600277 TTGGACCCATAGAGTAATCCAGG - Intronic
1192206778 X:69101605-69101627 TTTGGCCCCTGCAGCAATATCGG + Intergenic
1195511392 X:105719576-105719598 TTGTACCCATCAAGCAGTCTGGG + Intronic
1199810942 X:151347697-151347719 CTTAACCCAGGCAGCAATCTTGG + Intergenic
1200752035 Y:6954776-6954798 TTGGTCCTATTCAGCCATCTTGG + Intronic