ID: 1043486600

View in Genome Browser
Species Human (GRCh38)
Location 8:80704405-80704427
Sequence TGTACAGCAGGAGACAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043486600_1043486604 -6 Left 1043486600 8:80704405-80704427 CCATCCCTGTCTCCTGCTGTACA No data
Right 1043486604 8:80704422-80704444 TGTACAACTCCTAAAATCCTTGG No data
1043486600_1043486606 10 Left 1043486600 8:80704405-80704427 CCATCCCTGTCTCCTGCTGTACA No data
Right 1043486606 8:80704438-80704460 TCCTTGGAATCTCCAGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043486600 Original CRISPR TGTACAGCAGGAGACAGGGA TGG (reversed) Intronic