ID: 1043489697

View in Genome Browser
Species Human (GRCh38)
Location 8:80736690-80736712
Sequence CAGGGGAAATAGTGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043489685_1043489697 30 Left 1043489685 8:80736637-80736659 CCTGGCTATGGGGATGCAAAGGC 0: 1
1: 1
2: 12
3: 56
4: 239
Right 1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043489697 Original CRISPR CAGGGGAAATAGTGGGAGGA GGG Intronic
No off target data available for this crispr