ID: 1043497477

View in Genome Browser
Species Human (GRCh38)
Location 8:80818073-80818095
Sequence TCATGTAACTAGAGAGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043497477 Original CRISPR TCATGTAACTAGAGAGATCT GGG (reversed) Intronic
900829418 1:4955248-4955270 CCATGTAACTAGCCAGGTCTTGG + Intergenic
908589766 1:65617780-65617802 TCATTTAAACAGAGAGATATGGG - Intronic
911472517 1:98335707-98335729 TTTTGTAACCAGAGAGATCCAGG + Intergenic
917225348 1:172775698-172775720 TCAAGTAACTGCAGAGATTTGGG + Intergenic
918569876 1:185977059-185977081 TCAGGTAACCACAGAGATCAGGG - Intronic
919015987 1:192037132-192037154 TCATGTATATAGAGTGATATTGG + Intergenic
921480859 1:215663237-215663259 TCTTTTAACTAGTGAGATCCTGG + Intronic
1064132128 10:12719485-12719507 TCTTGTATCAAGAGAAATCTGGG + Intronic
1066323987 10:34336311-34336333 TCACCTAACTAAAAAGATCTGGG - Intronic
1067825853 10:49572401-49572423 TCATGTCCCTGAAGAGATCTAGG + Intergenic
1071139898 10:82496494-82496516 TCATGTCAATAGAGAGTTCTGGG - Intronic
1071941669 10:90597838-90597860 TCAGGGAACTAGAAAGATATGGG - Intergenic
1074957413 10:118405877-118405899 ACATGACACTAGAGAGATCTAGG - Intergenic
1075603623 10:123788767-123788789 TTTTGAAACTAGAGAGAGCTGGG + Intronic
1079280753 11:19084899-19084921 TCATGTCACTAGACAGCTCACGG - Intergenic
1080009273 11:27441145-27441167 TCATAGAACTAGAGAAATATTGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1088518748 11:110670322-110670344 GCCTTTAACTAGACAGATCTAGG + Intronic
1093648489 12:21616620-21616642 CCCTGTTACTAGAGAGACCTAGG - Intergenic
1095275512 12:40277762-40277784 TCATTTAACTATAGATATATTGG - Intronic
1095527938 12:43150366-43150388 TCATGTTACTGGACAGCTCTGGG + Intergenic
1109944231 13:69410847-69410869 CTGTGTAACTAGAGAGCTCTTGG - Intergenic
1111556762 13:89890920-89890942 CCATGTAAGTAGAGAGTTTTGGG + Intergenic
1113189365 13:107726444-107726466 TCATGTATCTAGTGTGAACTCGG - Intronic
1114061425 14:19020520-19020542 TCATGTTACCAGAGAATTCTTGG + Intergenic
1114100822 14:19379444-19379466 TCATGTTACCAGAGAATTCTTGG - Intergenic
1116700554 14:48236434-48236456 TCATGGCACTAGAAAGATCCTGG - Intergenic
1119756176 14:77121300-77121322 TCATGTCTCTACAGAGAGCTGGG + Intronic
1120700101 14:87690289-87690311 TGAGGTAAATAGAGAGAGCTAGG - Intergenic
1121372874 14:93376259-93376281 TGAGGGAACTAGAGAGATTTTGG + Intronic
1126735172 15:51725272-51725294 TGAAATAACTAGAGATATCTGGG - Intronic
1129464102 15:75714129-75714151 TCTTGAAACCAGAGAGACCTGGG + Intergenic
1129721089 15:77878575-77878597 TCTTGAAACCAGAGAGACCTGGG - Intergenic
1134680831 16:16124157-16124179 TCTTGTTACGAGACAGATCTGGG - Intronic
1135874799 16:26188526-26188548 TCATGTAACTAAAAAGCTCAGGG - Intergenic
1136411675 16:30081247-30081269 TCCTGTCTCCAGAGAGATCTTGG + Exonic
1142654057 17:1378444-1378466 TCATGTGACTAGCAAGATATTGG - Intronic
1146874358 17:36396479-36396501 TTTTGAAACCAGAGAGATCTGGG + Intronic
1146965488 17:37025143-37025165 TCAGGGAACTAGATAGGTCTTGG + Intronic
1147065028 17:37916392-37916414 TTTTGAAACCAGAGAGATCTGGG - Intergenic
1147504345 17:41000361-41000383 TCATGTGACTACAGGCATCTCGG + Intergenic
1149313186 17:55416139-55416161 TCATCTAACTACAGCCATCTTGG - Intronic
1149582175 17:57758249-57758271 TCATGAAACCGGAAAGATCTGGG - Intergenic
1154394292 18:13972769-13972791 TCTTTTAAGTAGTGAGATCTTGG + Intergenic
1156638587 18:39062305-39062327 TCATGTAACTTAAGATATATTGG - Intergenic
1158537861 18:58324102-58324124 TCATGTATATAGAGAGATGAAGG - Intronic
1159786155 18:72717169-72717191 TCATTTAGATAGAGAGATCATGG + Intergenic
925482137 2:4286990-4287012 ACTAGAAACTAGAGAGATCTGGG + Intergenic
928784525 2:34866562-34866584 TCATGTAACTAGAGAAAAGCTGG - Intergenic
931354838 2:61527564-61527586 TTTTGTATTTAGAGAGATCTTGG - Intronic
934045861 2:88172023-88172045 TCATGTAGGTAGAGAGCTTTGGG + Exonic
936225675 2:110648137-110648159 TCATCTAATGAAAGAGATCTTGG - Intronic
938212623 2:129481390-129481412 TCATGGAACAAGGGAGAGCTCGG + Intergenic
941789237 2:169533019-169533041 TCACATAAGTAGAGAGATATGGG - Intronic
947243813 2:228024105-228024127 TCATGTAACCAGAAAAATCCAGG - Intronic
948175753 2:235941434-235941456 TTTTGTACCTAGAGAGACCTGGG - Intronic
1173443540 20:43097879-43097901 TCATGTAACAAGAGAAGTTTTGG - Intronic
1180479913 22:15743118-15743140 TCATGTTACCAGAGAATTCTTGG + Intergenic
951190581 3:19765412-19765434 TCATGTAACTAGCTATATCATGG + Intergenic
951395252 3:22157158-22157180 TCATGTAACTGGAAAGAGGTAGG - Intronic
952201940 3:31138661-31138683 TCATGTAACTTAAGAGGTCAGGG - Intergenic
953739400 3:45524083-45524105 TCATGTAACCTCAGAGATCTGGG + Exonic
955038480 3:55292182-55292204 TCATGTAACTACAGAAGTCAAGG + Intergenic
956922615 3:73945957-73945979 TCATATAACCAGAAAGTTCTAGG - Intergenic
956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG + Intergenic
956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG + Intergenic
957970593 3:87376785-87376807 AGATGTAACTAGATAGACCTTGG + Intergenic
958573076 3:95912214-95912236 CCATGGAACTAGAGGGAGCTGGG - Intergenic
958723482 3:97875250-97875272 TGATGTAGTTAGAGAGTTCTTGG + Exonic
964245272 3:154644599-154644621 TCATGGAACTAAAGAGATATAGG - Intergenic
967688242 3:192442672-192442694 TCATGTAAATACTGAGATTTTGG - Intronic
970408129 4:15783106-15783128 TCATGTGCCCAGAGACATCTTGG - Intronic
970784369 4:19778479-19778501 TCATATAACTTGAGAGTTCATGG + Intergenic
971865311 4:32162868-32162890 TGATTTAAGTGGAGAGATCTGGG + Intergenic
972652165 4:41028755-41028777 TCATGAAATTAGAGTGATCCTGG - Intronic
975736618 4:77387702-77387724 TACTGAAACTAGAGACATCTAGG + Intronic
976069545 4:81225289-81225311 TCATGAAACTAGAAAGATGGAGG - Intergenic
976845693 4:89486991-89487013 TCAACTAATTAGGGAGATCTAGG + Intergenic
978028973 4:103914836-103914858 TCATGTAATTTCAGAAATCTAGG + Intergenic
979569829 4:122208301-122208323 TCATACAACTAGAGAGTTATTGG + Intronic
979619092 4:122778208-122778230 TCATTTTATTACAGAGATCTGGG - Intergenic
983737661 4:171083080-171083102 TCAGATAAAAAGAGAGATCTGGG - Intergenic
986097350 5:4572618-4572640 ACATGTCAGTAGAGAGTTCTGGG - Intergenic
987733240 5:21804833-21804855 ACATGTAATTATAGAGAACTTGG - Intronic
988499326 5:31771233-31771255 TCATGTAACTATTCAGAGCTAGG + Intronic
990119042 5:52426014-52426036 TCATGTAAAAACAGAGGTCTTGG + Intergenic
991185952 5:63807756-63807778 TTATGATACTAGAGAGATGTAGG + Intergenic
992173424 5:74126151-74126173 TCATGAAATTTGAGTGATCTAGG - Intergenic
993740110 5:91528435-91528457 TCAGCTAACTAGAGGGATTTGGG + Intergenic
1000441807 5:161272437-161272459 TGATGTAACTAAAGAGTCCTGGG + Intergenic
1007789117 6:44298812-44298834 TCATCTAGCAACAGAGATCTAGG + Intronic
1008948524 6:57127841-57127863 TAATATAACTAGAAAGATTTAGG + Intronic
1014294092 6:119596969-119596991 TCATAAAATTAAAGAGATCTAGG + Intergenic
1023805603 7:43870645-43870667 TCATGTAATCAGAGGAATCTTGG - Intronic
1026390950 7:69901057-69901079 CCACGGAACTAGAGATATCTGGG - Intronic
1028154075 7:87409538-87409560 TCTAGTAACAAGAGAAATCTAGG + Intronic
1028555550 7:92119871-92119893 CCATTTTACTAGAGATATCTAGG - Intronic
1031678543 7:124641639-124641661 TCCTGTCACTAAAGGGATCTAGG - Intergenic
1033870672 7:145750730-145750752 AAATGTAACCAGAGAGTTCTGGG + Intergenic
1034921902 7:155090284-155090306 TCATGTATCTGGAGAGCACTTGG + Intergenic
1037269223 8:17107865-17107887 TCATGTTTCAAGAGATATCTTGG + Intronic
1038182018 8:25238156-25238178 TCATTTAAAGAGAGAAATCTAGG + Intronic
1040430035 8:47330747-47330769 TCATCTACCAAGAGACATCTGGG + Intronic
1040443751 8:47472309-47472331 TCATGTAACTCAAGAAGTCTTGG + Intronic
1040980749 8:53244108-53244130 TCTTGGAACTAGAGAAATGTGGG - Intronic
1042284511 8:67093319-67093341 TCATGTGACAAGAAAGACCTGGG + Intronic
1043497477 8:80818073-80818095 TCATGTAACTAGAGAGATCTGGG - Intronic
1044639994 8:94369177-94369199 TCATGGAACTGAAGAGATTTAGG - Intergenic
1048036424 8:130681662-130681684 TCATGTAGCTAAACAGATCTGGG - Intergenic
1052808263 9:33032999-33033021 TTAGGTAACCAGAGTGATCTTGG + Intronic
1053449348 9:38180177-38180199 TTATGTAACTGGATAGCTCTTGG - Intergenic
1056673744 9:88655315-88655337 ACAGGGAACTAGAGCGATCTGGG + Intergenic
1061639709 9:131942975-131942997 ACAGGTAAGTAAAGAGATCTGGG + Intronic
1186975826 X:14903519-14903541 TCATGTCACTACAGTGATTTGGG - Intronic
1188778897 X:34255274-34255296 TCATGTAAGAAGAGAGATAATGG - Intergenic
1189759200 X:44304187-44304209 TGATGTAATTAGAGAGTCCTAGG + Intronic
1191970189 X:66805423-66805445 TCATCTAACTTGAGGGCTCTAGG - Intergenic
1192321150 X:70091750-70091772 TCATGTTGCCAGAGAGATCCAGG + Intergenic
1192890104 X:75381375-75381397 CCCACTAACTAGAGAGATCTGGG - Intronic
1193914413 X:87348281-87348303 TAATGTAAATAGATAGTTCTAGG - Intergenic
1197178486 X:123509634-123509656 TGAAGAAACTAGATAGATCTTGG + Intergenic