ID: 1043498451

View in Genome Browser
Species Human (GRCh38)
Location 8:80828830-80828852
Sequence GACTCTGGAAAGTCTCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 163}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043498451_1043498456 -8 Left 1043498451 8:80828830-80828852 CCAACATGAGACTTTCCAGAGTC 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1043498456 8:80828845-80828867 CCAGAGTCCAGGGATGACTTGGG No data
1043498451_1043498462 18 Left 1043498451 8:80828830-80828852 CCAACATGAGACTTTCCAGAGTC 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1043498462 8:80828871-80828893 TGGAATCCACTTGGCTGGCATGG No data
1043498451_1043498457 -2 Left 1043498451 8:80828830-80828852 CCAACATGAGACTTTCCAGAGTC 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1043498457 8:80828851-80828873 TCCAGGGATGACTTGGGCCTTGG No data
1043498451_1043498454 -9 Left 1043498451 8:80828830-80828852 CCAACATGAGACTTTCCAGAGTC 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1043498454 8:80828844-80828866 TCCAGAGTCCAGGGATGACTTGG No data
1043498451_1043498459 9 Left 1043498451 8:80828830-80828852 CCAACATGAGACTTTCCAGAGTC 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1043498459 8:80828862-80828884 CTTGGGCCTTGGAATCCACTTGG No data
1043498451_1043498460 13 Left 1043498451 8:80828830-80828852 CCAACATGAGACTTTCCAGAGTC 0: 1
1: 0
2: 2
3: 7
4: 163
Right 1043498460 8:80828866-80828888 GGCCTTGGAATCCACTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043498451 Original CRISPR GACTCTGGAAAGTCTCATGT TGG (reversed) Intronic
904884161 1:33724045-33724067 GACTCTGGAAGTTTTCTTGTTGG + Intronic
907124327 1:52035813-52035835 TAGTCTGTAAAGTCTCAAGTAGG - Intronic
907444295 1:54498258-54498280 CACGCTGGGAAGTGTCATGTGGG - Intergenic
907700110 1:56777919-56777941 GCCTCTGGAAAGTCTTAAGCAGG - Intronic
909826355 1:80132130-80132152 TACTCTAGAAATTCTCATTTAGG - Intergenic
913614421 1:120543175-120543197 GACTATGGAGAGTCTCCTGAGGG - Intergenic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
916650965 1:166834127-166834149 GACTCTGGTAAAACCCATGTTGG - Intergenic
919094389 1:193012238-193012260 CAGTGGGGAAAGTCTCATGTAGG - Exonic
921099339 1:211914916-211914938 TGCTCTGGAAAATCTCAGGTGGG - Intergenic
923977523 1:239280638-239280660 CAGCCTGGAAAGTCTCAGGTGGG - Intergenic
924281512 1:242442166-242442188 GCCTTTGGAATGTCTCATGATGG - Intronic
1069183216 10:65389741-65389763 GACACTAAAAAGTATCATGTTGG - Intergenic
1069569467 10:69485655-69485677 GCCTTTGGAGAGTCTTATGTGGG + Intronic
1070512882 10:77177121-77177143 GCCTCTGGAGAGACCCATGTTGG + Intronic
1073333477 10:102686830-102686852 GACTTTGGAAAGTCTGAGCTAGG + Intronic
1075516376 10:123111977-123111999 GCCTCTGGAAAGTCTGCTATAGG - Intergenic
1078024821 11:7685027-7685049 GACTCAAGAAATTCTCATGGAGG + Intergenic
1079748059 11:24157868-24157890 GAATCTGGAAACTCAAATGTTGG - Intergenic
1080177476 11:29383200-29383222 AACGCTGGAAAATCTGATGTTGG + Intergenic
1080527247 11:33136111-33136133 GACTCAGGAAAGCATAATGTGGG - Intronic
1081616541 11:44594785-44594807 GGCTCTGGAAAGGCTCAGGCTGG - Intronic
1083443442 11:62691604-62691626 GACCTTGGGAAGTCTCCTGTGGG + Intronic
1084077422 11:66791227-66791249 GACTGAGGAAAGTTTCATTTAGG + Intronic
1088182545 11:107128633-107128655 GAGTCTGGACTGTCTCCTGTAGG - Intergenic
1088724327 11:112620959-112620981 GACTCTGAAATGACTCTTGTGGG + Intergenic
1090567783 11:128014699-128014721 GATTCTGGAAAGTATCTTGAGGG - Intergenic
1091003676 11:131932739-131932761 GCATCTGGAAAGTCCCCTGTGGG - Intronic
1095519782 12:43049875-43049897 CTTTCTGGAAAGTCTCAGGTGGG + Intergenic
1099532837 12:83807158-83807180 GATTCTGGAAAGTCTGATTCAGG + Intergenic
1099754497 12:86826393-86826415 GACTCTCAAAAGTCTAGTGTAGG + Intronic
1100106854 12:91185786-91185808 GACTCTGCAAAGTCAGATCTGGG + Intergenic
1103009918 12:117450180-117450202 GGCTCTGGAGAGTCTCATTCTGG + Intronic
1104050018 12:125188591-125188613 GGCTCTGGAAGGCCCCATGTTGG + Intronic
1108583316 13:51845864-51845886 GACTCTGCTAAGTCTCCTGTAGG + Intergenic
1109289132 13:60451872-60451894 GACTCTTAAAAATATCATGTTGG + Intronic
1111216501 13:85149524-85149546 GACTCTGGAAATACTTTTGTAGG - Intergenic
1111682652 13:91462658-91462680 GTCTCTGGAAAGTATAATTTGGG + Intronic
1114206643 14:20578440-20578462 AGCTCTGGAAAGTCTCCTGCTGG - Intergenic
1116288525 14:43003893-43003915 GCCTCTTGCAAGCCTCATGTAGG + Intergenic
1118644035 14:67819853-67819875 GGTACTGGAAAGTTTCATGTGGG + Exonic
1120728817 14:87978745-87978767 GTGTCTGGAAAATCTCATCTAGG - Intronic
1122904062 14:104793933-104793955 GGCTGTGGAAAGACCCATGTTGG - Exonic
1127710033 15:61588055-61588077 GAATCTGAGAAGACTCATGTTGG + Intergenic
1131999596 15:98165277-98165299 GTCTCTGGAAGGTCTCCTGCTGG + Intergenic
1133588794 16:7222313-7222335 TAATGTGCAAAGTCTCATGTTGG + Intronic
1134536230 16:15028905-15028927 GACTCCTGAAGGTGTCATGTTGG - Exonic
1138813637 16:60179053-60179075 GACTATAGAAAGTCCAATGTGGG + Intergenic
1138995358 16:62445252-62445274 TGCTCTGCAAAGTCTCTTGTGGG + Intergenic
1141863792 16:86735945-86735967 GACTCTGCAAGGTCTCATGGGGG + Intergenic
1142681746 17:1553909-1553931 GAATCTGTAATATCTCATGTGGG - Intronic
1147044703 17:37744100-37744122 GGGTCTGGAAAGCCGCATGTCGG - Intronic
1148964550 17:51423666-51423688 GCCCCTGAAAAGTCTCATCTTGG - Intergenic
1149415234 17:56452561-56452583 AACTCTTGAAGGTCTCATATGGG + Intronic
1150659736 17:67064878-67064900 TACCCTGCAAAGTCTCTTGTGGG + Intergenic
1152737346 17:82004026-82004048 GACGCTGGAAACTCTGAGGTTGG + Intronic
1154299888 18:13183877-13183899 GGCTGGGGAAAGTGTCATGTTGG + Intergenic
1156747244 18:40407156-40407178 GACTCTGGAGTGTCTCTTTTTGG - Intergenic
1156784659 18:40895754-40895776 GACACTGGAAACTCAGATGTGGG - Intergenic
1159707130 18:71705577-71705599 GACTCTTCTAAGTTTCATGTGGG + Intergenic
1159868556 18:73734770-73734792 GACTCTGGAATTTCTGAAGTAGG - Intergenic
1160473307 18:79159365-79159387 GACACTGGAGAGACTGATGTAGG - Intronic
1161153861 19:2722353-2722375 GACTCTGGAGAGACCCCTGTGGG - Intronic
1164726453 19:30468900-30468922 GCCTCTGGACATTCTCAGGTGGG - Intronic
1165747693 19:38239998-38240020 TACTCTGGAAATGCTCTTGTCGG - Intergenic
1166171740 19:41032620-41032642 GACCCTGGAAAGTGCCTTGTGGG + Intergenic
925576979 2:5370295-5370317 GACTCTGGGAATTCAAATGTCGG + Intergenic
928184243 2:29095216-29095238 GTCCCTGGAAAGTCTTATTTTGG + Intergenic
930436148 2:51345075-51345097 GAGTCTTGAAAGGCTCAGGTTGG + Intergenic
931104939 2:59045212-59045234 CACTCTGGAAAGTTTCATAATGG + Intergenic
932277958 2:70465523-70465545 GCCTCTGGCAAGTCTTATGGAGG + Intronic
934125647 2:88886559-88886581 GACTCTGGAAAGTTTCTACTTGG + Intergenic
934854923 2:97723793-97723815 GTCTCTGGAAAGTCAGATGGGGG + Intronic
936514655 2:113174108-113174130 GAATGTGGAGAGTCACATGTGGG + Intronic
937042405 2:118832790-118832812 AACTCTGGAAATTCTCTTTTAGG + Intergenic
937536337 2:122893157-122893179 GATTCTCAAAAGTCTCATATTGG + Intergenic
937549568 2:123070284-123070306 GACTCAGGAAGGTCTCCTGGTGG + Intergenic
939628560 2:144508627-144508649 TGCTTTGGAAAGTCTCAAGTTGG + Intronic
939999342 2:148951326-148951348 GGATCTAGGAAGTCTCATGTGGG - Intronic
940520557 2:154740526-154740548 AAAACTGGAAAGTCTCATCTAGG - Intronic
942127413 2:172841099-172841121 GGCTCCACAAAGTCTCATGTTGG + Intronic
943976092 2:194479798-194479820 CACTCAGGAAACTCTCTTGTGGG - Intergenic
948393616 2:237628963-237628985 GAGTCTGGAAGGTCTCCTGGAGG - Intronic
1168841517 20:912863-912885 GACTCTGGAAGGTGTCAAGGAGG - Intronic
1170047023 20:12096324-12096346 GACTCTGGCAATTCTTCTGTGGG + Intergenic
1174121375 20:48268324-48268346 CACTCTGGAAAGCCTGTTGTGGG + Intergenic
1176944990 21:14968975-14968997 GACTCTGATGAGTCTGATGTGGG + Intronic
1177205854 21:18010355-18010377 AACTCAGGAAAGTCTCCTGGTGG + Intronic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1179284848 21:39968488-39968510 GAGGCTGGAAAGTCTCAATTTGG + Intergenic
1179390042 21:40980091-40980113 GGCTTTGGGAAGTCACATGTGGG + Intergenic
1184596680 22:45518223-45518245 TCCTCTGGAAAGAGTCATGTCGG + Intronic
1184810926 22:46831266-46831288 GTCTCTGTAGAGTCTCCTGTTGG + Intronic
1185249494 22:49792641-49792663 GACTCTAGAATGTCTCTTTTGGG - Intronic
949388095 3:3527451-3527473 AAGTCTGGAAATTCGCATGTTGG - Intergenic
949439952 3:4069841-4069863 TACCCTGAAAAGTCTCTTGTGGG + Intronic
949915347 3:8958432-8958454 GACGCTGGAAAGACTCATGTTGG - Intronic
953451765 3:43012146-43012168 GACTGTGGAAAGTCACAGGAAGG + Intronic
954865433 3:53725177-53725199 GTCTGTGGAAAGTCTCCTATAGG - Intronic
958454693 3:94315886-94315908 GAGGCTGGAAAGTCTGATGTGGG + Intergenic
958901377 3:99891090-99891112 GAATCTGCAAATTCTCGTGTGGG + Intronic
960684642 3:120284708-120284730 GACTCTGGAAAGTCTACAGGCGG + Intronic
969124119 4:4933621-4933643 GGCCCTGCCAAGTCTCATGTTGG + Intergenic
970565394 4:17327232-17327254 GACTCTGGAAGGTCCCTTGGAGG - Intergenic
976839597 4:89416383-89416405 GCCTCATGAAAGACTCATGTAGG - Intergenic
977628833 4:99218900-99218922 GACTCTGGAAATTCTGATAAAGG + Intronic
982758752 4:159254899-159254921 GACTATTTAAAGTCTCATGCTGG - Intronic
984393246 4:179165872-179165894 TGCTCTGCAAAGTCTCTTGTGGG + Intergenic
986711565 5:10491694-10491716 GAATCTGGAGAGACTCATGCTGG + Intergenic
986977496 5:13410434-13410456 GACTCTGGAAAGGCTAATCCAGG - Intergenic
987558555 5:19487136-19487158 GACTTTGGAAAGTATCACATAGG + Intronic
987986303 5:25151862-25151884 GACTCTGTAAACTGTCATGGAGG - Intergenic
988307993 5:29518609-29518631 AACTTGGGAAAGTCTCTTGTAGG - Intergenic
988601872 5:32647825-32647847 GACTCTAGAAAATCTCAAGATGG - Intergenic
988912755 5:35861309-35861331 GACACTGGATTGTCTCGTGTTGG - Intronic
990793954 5:59519028-59519050 GACAGCAGAAAGTCTCATGTTGG - Intronic
991550769 5:67833567-67833589 GGCTTTGGAATGCCTCATGTAGG + Intergenic
992162235 5:74014846-74014868 GAGGCTGGAAAATATCATGTAGG - Intergenic
992720806 5:79559664-79559686 TTCCCTGGAAAGTCTCTTGTGGG + Intergenic
992823654 5:80525558-80525580 GACTCAGGAAGGTCTCAGGAGGG + Intronic
993355033 5:86895510-86895532 GCCTATGGAAAGGCTCATCTTGG - Intergenic
996115841 5:119617410-119617432 AATTCTGGAAAGTCTCACTTGGG - Intronic
996783072 5:127209532-127209554 GACTCAGGATAGTCTCAAGGTGG + Intergenic
997768569 5:136530274-136530296 TCCTCTGGAAATTCTCTTGTAGG + Intergenic
999226873 5:150032975-150032997 TAATCTGCAAAGTCTCAGGTTGG - Intronic
999285163 5:150390267-150390289 TACGCTGGAAAATCTCATGAGGG - Intronic
999955407 5:156696092-156696114 GACTCTGGAACTGTTCATGTGGG + Intronic
1000508074 5:162146833-162146855 GACAGTGGAAAGACTGATGTTGG - Intronic
1001447759 5:171799105-171799127 CACTCTGGGAACTCTCATGTGGG - Intergenic
1008485483 6:52030606-52030628 GCCTCTGGAAGGTCTCATGCTGG - Intronic
1010630714 6:78194166-78194188 GAGTCTGGAAAGGGTAATGTGGG - Intergenic
1010734889 6:79432952-79432974 GAGTCTGAAAAGTCTGCTGTGGG + Intergenic
1014858604 6:126434227-126434249 GAGTTTGGCAAGTTTCATGTTGG - Intergenic
1016882192 6:148922029-148922051 AGCACTGGAAAGTCTCATGGTGG + Intronic
1017682417 6:156877575-156877597 GACTCTGAAAATACTCATGAGGG - Intronic
1018431142 6:163723700-163723722 GAATTTGGAAAGGCTCTTGTGGG + Intergenic
1020796350 7:12682418-12682440 GACTCCGGAAATTCTTATCTAGG + Intergenic
1022313977 7:29227247-29227269 GAATCTGGATAGTTTAATGTAGG - Intronic
1025870347 7:65425707-65425729 GAATCTGGGTACTCTCATGTTGG - Intergenic
1028716197 7:93972603-93972625 CACTCTGAAAAGTCTCTTCTTGG - Intronic
1030814006 7:114011846-114011868 GAATCTGGAAAGTATTAGGTTGG - Intronic
1031734525 7:125340986-125341008 GACTCTGAAAAGTCTCCATTTGG + Intergenic
1035230162 7:157460457-157460479 TACTCTGGCAAGTCTGATGTTGG + Intergenic
1037289765 8:17337887-17337909 AGCTCTGGAAGTTCTCATGTGGG + Intronic
1038001482 8:23395618-23395640 GACACTTGAAAGTGTCATGCAGG + Intronic
1038696330 8:29810020-29810042 TCCACTGGAGAGTCTCATGTTGG - Intergenic
1040115815 8:43617746-43617768 GACTCTGCAAAGTGACATTTTGG + Intergenic
1040117174 8:43635623-43635645 GAATCTGCAAAGTATCATTTGGG + Intergenic
1041194034 8:55382579-55382601 GATTCTGGAAAATCTCAACTAGG + Intronic
1043232906 8:77824878-77824900 GACTCTGGTAAAACACATGTTGG + Intergenic
1043498451 8:80828830-80828852 GACTCTGGAAAGTCTCATGTTGG - Intronic
1044371550 8:91418192-91418214 GACTTTGAAAAGACTCAGGTAGG + Intergenic
1046174524 8:110557860-110557882 GACACTGGAAAGTCTTTTGGAGG + Intergenic
1050027067 9:1346487-1346509 GACTCTGGTAAGTCCTATGGAGG - Intergenic
1050423208 9:5488328-5488350 GAGTCAGGAAAGCCTCAAGTTGG + Intergenic
1052479623 9:29007328-29007350 GACTGTGGAAATTTTCATTTTGG + Intergenic
1054763883 9:69026699-69026721 GACTCTGGAAAGGGTTATTTTGG - Intergenic
1054823941 9:69551994-69552016 AACTCTGAACAGTTTCATGTTGG - Intronic
1055140444 9:72871220-72871242 GACTCTGCAGAGTCCCATGGTGG + Intergenic
1056779355 9:89537992-89538014 CACTCAGGAAAGTGTCTTGTGGG - Intergenic
1057349337 9:94282043-94282065 TGCTCTGCAAAGTCTCTTGTGGG - Intronic
1059577775 9:115509489-115509511 GACTCTGGAGAGTCTCAAATGGG + Intergenic
1061180782 9:129023873-129023895 TGCTCTGGAAGGTCTCATTTTGG - Intronic
1061767879 9:132893609-132893631 GACTCTGGTTAGTGTCAGGTGGG + Exonic
1187996878 X:24936271-24936293 GATTTTGGAAAGTCTCAAGATGG + Intronic
1188801452 X:34536163-34536185 GACTCTGCAGAGTCTCAAGATGG - Intergenic
1189220482 X:39367712-39367734 GCCTCTAGAAAGTCTCATGTCGG + Intergenic
1190812706 X:53900252-53900274 TACTTTGGAAAGACTCATGAGGG + Intergenic
1191853694 X:65605559-65605581 GACACTGGAGAGTTTCATGCAGG - Intronic
1191912929 X:66170720-66170742 GCCTCTGGACAGTGACATGTAGG + Exonic
1192327488 X:70145186-70145208 GATTCTGGAGAGTCTAAAGTGGG + Intronic
1193606635 X:83576497-83576519 AAATCTAGACAGTCTCATGTCGG - Intergenic
1197652196 X:129077404-129077426 CTATCTGGAAAGTCTCAAGTTGG - Intergenic