ID: 1043501769

View in Genome Browser
Species Human (GRCh38)
Location 8:80865402-80865424
Sequence ACAGAGAAGTAACAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043501765_1043501769 2 Left 1043501765 8:80865377-80865399 CCTGTGCCACATCACTTCTTGAT 0: 1
1: 0
2: 3
3: 11
4: 133
Right 1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG No data
1043501763_1043501769 9 Left 1043501763 8:80865370-80865392 CCCAGAGCCTGTGCCACATCACT 0: 1
1: 0
2: 2
3: 28
4: 348
Right 1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG No data
1043501764_1043501769 8 Left 1043501764 8:80865371-80865393 CCAGAGCCTGTGCCACATCACTT 0: 1
1: 0
2: 2
3: 21
4: 233
Right 1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG No data
1043501766_1043501769 -4 Left 1043501766 8:80865383-80865405 CCACATCACTTCTTGATCTACAG 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043501769 Original CRISPR ACAGAGAAGTAACAGTTGGG TGG Intronic
No off target data available for this crispr