ID: 1043502784

View in Genome Browser
Species Human (GRCh38)
Location 8:80873787-80873809
Sequence CAGCAGCACCGGCGACGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043502777_1043502784 -1 Left 1043502777 8:80873765-80873787 CCTCGTCTTCCTCCCCTAGAAGC 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502772_1043502784 13 Left 1043502772 8:80873751-80873773 CCCGCCCTCCTCGTCCTCGTCTT 0: 1
1: 1
2: 6
3: 77
4: 605
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502775_1043502784 8 Left 1043502775 8:80873756-80873778 CCTCCTCGTCCTCGTCTTCCTCC 0: 1
1: 14
2: 539
3: 4529
4: 10766
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502778_1043502784 -10 Left 1043502778 8:80873774-80873796 CCTCCCCTAGAAGCAGCAGCACC 0: 1
1: 0
2: 3
3: 31
4: 302
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502769_1043502784 25 Left 1043502769 8:80873739-80873761 CCGCCGCCTGCTCCCGCCCTCCT 0: 1
1: 1
2: 12
3: 119
4: 1271
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502776_1043502784 5 Left 1043502776 8:80873759-80873781 CCTCGTCCTCGTCTTCCTCCCCT 0: 1
1: 1
2: 31
3: 438
4: 3279
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502767_1043502784 29 Left 1043502767 8:80873735-80873757 CCCTCCGCCGCCTGCTCCCGCCC 0: 1
1: 1
2: 3
3: 73
4: 711
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502771_1043502784 19 Left 1043502771 8:80873745-80873767 CCTGCTCCCGCCCTCCTCGTCCT 0: 1
1: 0
2: 6
3: 77
4: 880
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502773_1043502784 12 Left 1043502773 8:80873752-80873774 CCGCCCTCCTCGTCCTCGTCTTC 0: 1
1: 1
2: 34
3: 332
4: 1910
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502766_1043502784 30 Left 1043502766 8:80873734-80873756 CCCCTCCGCCGCCTGCTCCCGCC 0: 1
1: 0
2: 7
3: 96
4: 851
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502768_1043502784 28 Left 1043502768 8:80873736-80873758 CCTCCGCCGCCTGCTCCCGCCCT 0: 1
1: 0
2: 10
3: 120
4: 919
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502774_1043502784 9 Left 1043502774 8:80873755-80873777 CCCTCCTCGTCCTCGTCTTCCTC 0: 1
1: 4
2: 106
3: 880
4: 3087
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data
1043502770_1043502784 22 Left 1043502770 8:80873742-80873764 CCGCCTGCTCCCGCCCTCCTCGT 0: 1
1: 0
2: 3
3: 77
4: 787
Right 1043502784 8:80873787-80873809 CAGCAGCACCGGCGACGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043502784 Original CRISPR CAGCAGCACCGGCGACGAGG CGG Intronic
No off target data available for this crispr