ID: 1043503952

View in Genome Browser
Species Human (GRCh38)
Location 8:80884610-80884632
Sequence AGGAAGAAGAAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043503948_1043503952 25 Left 1043503948 8:80884562-80884584 CCAGAACTTAAGAGGAGTGAGGA No data
Right 1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043503952 Original CRISPR AGGAAGAAGAAGAAAGAGGA AGG Intergenic
No off target data available for this crispr