ID: 1043504294

View in Genome Browser
Species Human (GRCh38)
Location 8:80887235-80887257
Sequence TGCAAGAAATGCAAAACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043504289_1043504294 8 Left 1043504289 8:80887204-80887226 CCAGCAGCAGCTGCTGCAGCCCC No data
Right 1043504294 8:80887235-80887257 TGCAAGAAATGCAAAACCTCAGG No data
1043504288_1043504294 15 Left 1043504288 8:80887197-80887219 CCATGGACCAGCAGCAGCTGCTG No data
Right 1043504294 8:80887235-80887257 TGCAAGAAATGCAAAACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043504294 Original CRISPR TGCAAGAAATGCAAAACCTC AGG Intergenic
No off target data available for this crispr