ID: 1043506717

View in Genome Browser
Species Human (GRCh38)
Location 8:80909995-80910017
Sequence ACGCACGCTGCTGGTGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043506714_1043506717 9 Left 1043506714 8:80909963-80909985 CCAGCTCTCTTCCTGCTTCTGCT 0: 60
1: 40
2: 25
3: 121
4: 1023
Right 1043506717 8:80909995-80910017 ACGCACGCTGCTGGTGCAAATGG No data
1043506715_1043506717 -2 Left 1043506715 8:80909974-80909996 CCTGCTTCTGCTATCTTGCTGAC 0: 35
1: 46
2: 47
3: 42
4: 222
Right 1043506717 8:80909995-80910017 ACGCACGCTGCTGGTGCAAATGG No data
1043506713_1043506717 13 Left 1043506713 8:80909959-80909981 CCAGCCAGCTCTCTTCCTGCTTC 0: 26
1: 30
2: 30
3: 100
4: 649
Right 1043506717 8:80909995-80910017 ACGCACGCTGCTGGTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043506717 Original CRISPR ACGCACGCTGCTGGTGCAAA TGG Intergenic
No off target data available for this crispr