ID: 1043507821

View in Genome Browser
Species Human (GRCh38)
Location 8:80920150-80920172
Sequence TAACACTCCTTGGAAACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043507818_1043507821 24 Left 1043507818 8:80920103-80920125 CCATAGACACTAGATTGCCTGTT No data
Right 1043507821 8:80920150-80920172 TAACACTCCTTGGAAACTACTGG No data
1043507819_1043507821 7 Left 1043507819 8:80920120-80920142 CCTGTTTTGATCTTTATTTTCAA No data
Right 1043507821 8:80920150-80920172 TAACACTCCTTGGAAACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043507821 Original CRISPR TAACACTCCTTGGAAACTAC TGG Intergenic
No off target data available for this crispr