ID: 1043516170

View in Genome Browser
Species Human (GRCh38)
Location 8:80996792-80996814
Sequence TTGAGTGAGGGGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043516162_1043516170 15 Left 1043516162 8:80996754-80996776 CCTTAAATGCAGTGCTTGGGGGT 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG No data
1043516163_1043516170 -8 Left 1043516163 8:80996777-80996799 CCTCGTTCTGTTCTTTTGAGTGA 0: 1
1: 0
2: 0
3: 19
4: 250
Right 1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG No data
1043516160_1043516170 16 Left 1043516160 8:80996753-80996775 CCCTTAAATGCAGTGCTTGGGGG 0: 1
1: 0
2: 2
3: 6
4: 144
Right 1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043516170 Original CRISPR TTGAGTGAGGGGAAGGTGGA GGG Intronic
No off target data available for this crispr